Seqanswers Leaderboard Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • anle
    Junior Member
    • Mar 2011
    • 7

    Confused with sam flags

    I have a paired end rna sequence alignment. I have a pair of reads that one has the flag 103 and the other 147
    103 means:
    read paired
    read mapped in proper pair
    read unmapped
    mate reverse strand
    first in pair

    147:
    read paired
    read mapped in proper pair
    read reverse strand
    second in pair

    Why it says that read are mapped in propper pairs since they map in different transcripts? how can my first read be unmapped? Here are the sequence output


    HWI-ST30398_7_64_11728_7000_0 103 isotig01097 3775 29 48S24M28S isotig03570 24 0 CTGTTCCAGAAATTGGTATTCAAAGAGTTCAATTTAAAACAAACGCCGAAGTGGCGCTTGAACCTATAAGTCCAGCGCCATTATCACCAATGTTATCATC gggggggfggggggggggggggfggggcgggggggfggggggggggggeggceegeeddgegdgcecggdaddc^dcdebggggegggag]edcfefggd XT:A:M NM:i:0 SM:i:29 AM:i:29 XM:i:0 XO:i:0 XG:i:0 MD:Z:24

    HWI-ST30398_7_64_11728_7000_0 147 isotig03570 24 29 37M1I62M isotig01097 3775 0 CAGCGCCATTATCACCAATGTTATCATCTTCCAATATAAAAAAAATCTTCATCGAGATTATCGTCTTTTCGTAAAATGAAAGCCCAATCTGTTGGTGGAG dXXcbd]^cadeecegfaegdeeedeefdadgggggegggggggdffffegedggggggggggggggggggggggggfgggggggggegggggggfgggg XT:A:U NM:i:1 SM:i:29 AM:i:29 X0:i:1 X1:i:0 XM:i:0 XO:i:1 XG:i:1 MD:Z:99

Latest Articles

Collapse

  • seqadmin
    Pathogen Surveillance with Advanced Genomic Tools
    by seqadmin




    The COVID-19 pandemic highlighted the need for proactive pathogen surveillance systems. As ongoing threats like avian influenza and newly emerging infections continue to pose risks, researchers are working to improve how quickly and accurately pathogens can be identified and tracked. In a recent SEQanswers webinar, two experts discussed how next-generation sequencing (NGS) and machine learning are shaping efforts to monitor viral variation and trace the origins of infectious...
    03-24-2025, 11:48 AM
  • seqadmin
    New Genomics Tools and Methods Shared at AGBT 2025
    by seqadmin


    This year’s Advances in Genome Biology and Technology (AGBT) General Meeting commemorated the 25th anniversary of the event at its original venue on Marco Island, Florida. While this year’s event didn’t include high-profile musical performances, the industry announcements and cutting-edge research still drew the attention of leading scientists.

    The Headliner
    The biggest announcement was Roche stepping back into the sequencing platform market. In the years since...
    03-03-2025, 01:39 PM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, 03-20-2025, 05:03 AM
0 responses
42 views
0 reactions
Last Post seqadmin  
Started by seqadmin, 03-19-2025, 07:27 AM
0 responses
53 views
0 reactions
Last Post seqadmin  
Started by seqadmin, 03-18-2025, 12:50 PM
0 responses
39 views
0 reactions
Last Post seqadmin  
Started by seqadmin, 03-03-2025, 01:15 PM
0 responses
194 views
0 reactions
Last Post seqadmin  
Working...