Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • anle
    Junior Member
    • Mar 2011
    • 7

    Confused with sam flags

    I have a paired end rna sequence alignment. I have a pair of reads that one has the flag 103 and the other 147
    103 means:
    read paired
    read mapped in proper pair
    read unmapped
    mate reverse strand
    first in pair

    147:
    read paired
    read mapped in proper pair
    read reverse strand
    second in pair

    Why it says that read are mapped in propper pairs since they map in different transcripts? how can my first read be unmapped? Here are the sequence output


    HWI-ST30398_7_64_11728_7000_0 103 isotig01097 3775 29 48S24M28S isotig03570 24 0 CTGTTCCAGAAATTGGTATTCAAAGAGTTCAATTTAAAACAAACGCCGAAGTGGCGCTTGAACCTATAAGTCCAGCGCCATTATCACCAATGTTATCATC gggggggfggggggggggggggfggggcgggggggfggggggggggggeggceegeeddgegdgcecggdaddc^dcdebggggegggag]edcfefggd XT:A:M NM:i:0 SM:i:29 AM:i:29 XM:i:0 XO:i:0 XG:i:0 MD:Z:24

    HWI-ST30398_7_64_11728_7000_0 147 isotig03570 24 29 37M1I62M isotig01097 3775 0 CAGCGCCATTATCACCAATGTTATCATCTTCCAATATAAAAAAAATCTTCATCGAGATTATCGTCTTTTCGTAAAATGAAAGCCCAATCTGTTGGTGGAG dXXcbd]^cadeecegfaegdeeedeefdadgggggegggggggdffffegedggggggggggggggggggggggggfgggggggggegggggggfgggg XT:A:U NM:i:1 SM:i:29 AM:i:29 X0:i:1 X1:i:0 XM:i:0 XO:i:1 XG:i:1 MD:Z:99

Latest Articles

Collapse

  • SEQadmin2
    Nine Things a Sample Prep Scientist Thinks About Before Sequencing
    by SEQadmin2


    I’m not a sequencing expert. I’m a purification scientist who uses NGS to evaluate workflows my group develops. With this perspective, we think about the sample first and the NGS workflow second. The sequencer is an exceptionally honest reporter, but it can only report on what you give it, so whether you get clean, interpretable data from an NGS workflow is largely determined before you begin.

    Here are nine questions we think about, in roughly the order they matter, before...
    06-18-2026, 07:11 AM
  • SEQadmin2
    From Collection to Sequencing: Why Sample Preparation and Preservation Define Sequencing Data
    by SEQadmin2


    Data variability is still an issue in sequencing technologies despite the advances in reproducibility and accuracy of these platforms. But the problem does not originate in the sequencing itself, but in the previous steps, before the sample reaches the sequencer.


    The first step is collection, followed by preservation and sample preparation for analysis. Most scientists overlook those steps, but not being careful might just be skewing the experiment’s results.
    ...
    06-02-2026, 10:05 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by SEQadmin2, 06-26-2026, 11:10 AM
0 responses
12 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 06-17-2026, 06:09 AM
0 responses
46 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 06-09-2026, 11:58 AM
0 responses
106 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 06-05-2026, 10:09 AM
0 responses
125 views
0 reactions
Last Post SEQadmin2  
Working...