Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Post a few lines from clc_trim_pair4.fq. Are you getting that error right away?

    Code:
    $ head -6 clc_trim_pair4.fq

    Comment


    • Originally posted by GenoMax View Post
      Post a few lines from clc_trim_pair4.fq. Are you getting that error right away?

      Code:
      $ head -6 clc_trim_pair4.fq
      This is what I get:
      @No_name
      CAACATTACCTAGTGCAAGACAGTGTTAATTTGAAGGCAGTTCATA
      +
      IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
      @No_name
      TTTTTTTTTTTTTTTTCTTTTCTCAACTTCCTTCACCTTCACACTCTCTTTCCCTTCTTC

      Comment


      • Is that all the sequence in the file? Just one record?

        If not, are all sequences called "NO_name"? That is not going to work since the names are not unique.

        Post output of.

        Code:
        $ ls -lh clc_trim_pair4.fq

        Comment


        • Hi all,
          I've been trying to download Bowtie2.2.5 for Mac and followed instructions on this forum. The consistent error message I've been getting is: (ERR): Expected bowtie2 to be in same directory with bowtie2-align: /Applications/bowtie2-2.2.5/
          I've followed suggestions from others with this problem to address this and I've realized that bowtie2-align is not in the folder I am downloading. Is this normal? Do I need to retrieve it elsewhere? I assume I am missing something basic since I am new to all this. Thanks in advance for any help.

          Comment


          • bowtie2 web site appears to be experiencing issues at the moment (can't get to the 2.2.6 code). Are you downloading the pre-compiled binary zip file for OS X from this link: http://sourceforge.net/projects/bowt...owtie2/2.2.5/? After uncompressing the archive all files you need should be in the uncompressed folder.

            Comment


            • Thanks for the reply. Yes I've downloaded that file but it does not contain bowtie2-align.

              Comment


              • I just checked the zip archive and the executables are all there (there are multiple align versions, bowtie2-align-l,bowtie2-align-s etc). You should run bowtie2 like so

                Code:
                $ bowtie2 -help

                Comment


                • Got it, thank you!

                  Comment


                  • error message: bowtie2 installation on mac

                    Hello, I'm not familiar to informatics and I try to install Bowtie2 on mac. I download bowtie2 source file.zip
                    I unzip it then when I did 'make' I have this error message:

                    1 error generated.
                    In file included from aligner_swsse_ee_u8.cpp:56:
                    In file included from ./aligner_sw.h:73:
                    ./sse_wrap.h:31:10: fatal error: 'simde/x86/sse2.h' file not found
                    #include "simde/x86/sse2.h"

                    Could you help me.

                    Thank you

                    Comment


                    • Download pre-compiled binary for macOS from here.

                      Consider using "conda" to install these programs that will save you a lot of time/headache.

                      Comment

                      Latest Articles

                      Collapse

                      • seqadmin
                        The Impact of AI in Genomic Medicine
                        by seqadmin



                        Artificial intelligence (AI) has evolved from a futuristic vision to a mainstream technology, highlighted by the introduction of tools like OpenAI's ChatGPT and Google's Gemini. In recent years, AI has become increasingly integrated into the field of genomics. This integration has enabled new scientific discoveries while simultaneously raising important ethical questions1. Interviews with two researchers at the center of this intersection provide insightful perspectives into...
                        02-26-2024, 02:07 PM
                      • seqadmin
                        Multiomics Techniques Advancing Disease Research
                        by seqadmin


                        New and advanced multiomics tools and technologies have opened new avenues of research and markedly enhanced various disciplines such as disease research and precision medicine1. The practice of merging diverse data from various ‘omes increasingly provides a more holistic understanding of biological systems. As Maddison Masaeli, Co-Founder and CEO at Deepcell, aptly noted, “You can't explain biology in its complex form with one modality.”

                        A major leap in the field has
                        ...
                        02-08-2024, 06:33 AM

                      ad_right_rmr

                      Collapse

                      News

                      Collapse

                      Topics Statistics Last Post
                      Started by seqadmin, Yesterday, 06:12 AM
                      0 responses
                      19 views
                      0 likes
                      Last Post seqadmin  
                      Started by seqadmin, 02-23-2024, 04:11 PM
                      0 responses
                      67 views
                      0 likes
                      Last Post seqadmin  
                      Started by seqadmin, 02-21-2024, 08:52 AM
                      0 responses
                      75 views
                      0 likes
                      Last Post seqadmin  
                      Started by seqadmin, 02-20-2024, 08:57 AM
                      0 responses
                      66 views
                      0 likes
                      Last Post seqadmin  
                      Working...
                      X