Post a few lines from clc_trim_pair4.fq. Are you getting that error right away?
Code:
$ head -6 clc_trim_pair4.fq
-
-
This is what I get:Originally posted by GenoMax View Post
@No_name
CAACATTACCTAGTGCAAGACAGTGTTAATTTGAAGGCAGTTCATA
+
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
@No_name
TTTTTTTTTTTTTTTTCTTTTCTCAACTTCCTTCACCTTCACACTCTCTTTCCCTTCTTCComment
-
Is that all the sequence in the file? Just one record?
If not, are all sequences called "NO_name"? That is not going to work since the names are not unique.
Post output of.
Code:$ ls -lh clc_trim_pair4.fq
Comment
-
Hi all,
I've been trying to download Bowtie2.2.5 for Mac and followed instructions on this forum. The consistent error message I've been getting is: (ERR): Expected bowtie2 to be in same directory with bowtie2-align: /Applications/bowtie2-2.2.5/
I've followed suggestions from others with this problem to address this and I've realized that bowtie2-align is not in the folder I am downloading. Is this normal? Do I need to retrieve it elsewhere? I assume I am missing something basic since I am new to all this. Thanks in advance for any help.Comment
-
bowtie2 web site appears to be experiencing issues at the moment (can't get to the 2.2.6 code). Are you downloading the pre-compiled binary zip file for OS X from this link: http://sourceforge.net/projects/bowt...owtie2/2.2.5/? After uncompressing the archive all files you need should be in the uncompressed folder.Comment
-
Thanks for the reply. Yes I've downloaded that file but it does not contain bowtie2-align.Comment
-
I just checked the zip archive and the executables are all there (there are multiple align versions, bowtie2-align-l,bowtie2-align-s etc). You should run bowtie2 like so
Code:$ bowtie2 -help
Comment
-
Got it, thank you!Comment
-
error message: bowtie2 installation on mac
Hello, I'm not familiar to informatics and I try to install Bowtie2 on mac. I download bowtie2 source file.zip
I unzip it then when I did 'make' I have this error message:
1 error generated.
In file included from aligner_swsse_ee_u8.cpp:56:
In file included from ./aligner_sw.h:73:
./sse_wrap.h:31:10: fatal error: 'simde/x86/sse2.h' file not found
#include "simde/x86/sse2.h"
Could you help me.
Thank youComment
-
Download pre-compiled binary for macOS from here.
Consider using "conda" to install these programs that will save you a lot of time/headache.Comment
-
CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).
Despite this, “CRISPR helped turn genome editing from a specialized technique into...07-31-2026, 11:01 AM
Comment