Post a few lines from clc_trim_pair4.fq. Are you getting that error right away?
Code:
$ head -6 clc_trim_pair4.fq
-
-
This is what I get:Originally posted by GenoMax View Post
@No_name
CAACATTACCTAGTGCAAGACAGTGTTAATTTGAAGGCAGTTCATA
+
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
@No_name
TTTTTTTTTTTTTTTTCTTTTCTCAACTTCCTTCACCTTCACACTCTCTTTCCCTTCTTCComment
-
Is that all the sequence in the file? Just one record?
If not, are all sequences called "NO_name"? That is not going to work since the names are not unique.
Post output of.
Code:$ ls -lh clc_trim_pair4.fq
Comment
-
Hi all,
I've been trying to download Bowtie2.2.5 for Mac and followed instructions on this forum. The consistent error message I've been getting is: (ERR): Expected bowtie2 to be in same directory with bowtie2-align: /Applications/bowtie2-2.2.5/
I've followed suggestions from others with this problem to address this and I've realized that bowtie2-align is not in the folder I am downloading. Is this normal? Do I need to retrieve it elsewhere? I assume I am missing something basic since I am new to all this. Thanks in advance for any help.Comment
-
bowtie2 web site appears to be experiencing issues at the moment (can't get to the 2.2.6 code). Are you downloading the pre-compiled binary zip file for OS X from this link: http://sourceforge.net/projects/bowt...owtie2/2.2.5/? After uncompressing the archive all files you need should be in the uncompressed folder.Comment
-
Thanks for the reply. Yes I've downloaded that file but it does not contain bowtie2-align.Comment
-
I just checked the zip archive and the executables are all there (there are multiple align versions, bowtie2-align-l,bowtie2-align-s etc). You should run bowtie2 like so
Code:$ bowtie2 -help
Comment
-
Got it, thank you!Comment
-
error message: bowtie2 installation on mac
Hello, I'm not familiar to informatics and I try to install Bowtie2 on mac. I download bowtie2 source file.zip
I unzip it then when I did 'make' I have this error message:
1 error generated.
In file included from aligner_swsse_ee_u8.cpp:56:
In file included from ./aligner_sw.h:73:
./sse_wrap.h:31:10: fatal error: 'simde/x86/sse2.h' file not found
#include "simde/x86/sse2.h"
Could you help me.
Thank youComment
-
Download pre-compiled binary for macOS from here.
Consider using "conda" to install these programs that will save you a lot of time/headache.Comment
-
Tumors contain complex mixtures of cell populations that evolve in response to treatment and host-specific factors. Tissue biopsies provide only static snapshots of a tumor’s state. But what if we could follow that evolution over time using a minimally invasive technique?
Liquid biopsies can detect tumor-derived material circulating in the bloodstream, providing a way to study treatment response, detect emerging resistance, and discover new biomarkers. Circulating...Today, 09:55 AM -
Researchers using sequencing and genomics tools often have to make trade-offs. They can choose between speed or scale, short reads or long-range information, or targeted panels or a view of the whole transcriptome. New technologies that have been released this year are built to address those tough choices.
We asked six companies the same four questions to learn about their latest products. The new technologies bring a lot to the table, including rethinking sequencing...
Comment