[GenoMax]

You should use fastq reads for the bowtie2 alignment (you are back on the right track). Unless you know that you have data with Q scores less than 10 (e.g. based on FastQC analysis) it should be fine to proceed without explicit quality score filtering.

[kaps]

Hi GenoMax,

I rectified the typing error (U instead of v). however, when i try to run bowtie, this the comment I get: bowtie2 -x RNAseq4 -U 4_S4_L001_R1_001_paired_trimmed_paired.fa -S RNAseq4.sam
Error: reads file does not look like a FASTQ file
terminate called after throwing an instance of 'int'
(ERR): bowtie2-align died with signal 6 (ABRT)

I imported the read file (.fa) from Clc genomics workbench (The software pairs the forward-R1 and reverse-R2 into one file).

I have decided to use the raw reads (R1 and R2) as obtained from illumina. I have however only trimmed with out first performing a quality filter. and i have proceeded with bowtie for paired end reads. Will these affect the alignment results?

[GenoMax]

You have a "v" instead of a "U" before your read file (if the command above is correct).

If you have paired-end reads (which it seems you do, from the R1 in your file name) you should map the pairs together at the same time using the example command I have included above.

[kaps]

Tried the alignment but I am getting an error:

here is the script: bowtie2 -p 2 -x RNAseq4 -v 4_S4_L001_R1_001_paired_trimmed_paired.fa RNAseq4.sam
and here is report on the terminal:

Command: /export/apps/bowtie2/2.2.5/bowtie2-align-s --wrapper basic-0 -p 2 -x RNAseq4 -v 4_S4_L001_R1_001_paired_trimmed_paired.fa RNAseq4.sam
(ERR): bowtie2-align exited with value 1

where am going wrong?

[GenoMax]

Installed RAM IS 2 GB.
I have access to a unix server.
There are a number of bowtie modules installed already( the latest is bowtie2/2.2.5). Trying to read through the Bowtie manual so that I try analysis on the server. A quick guide from you or any other member on the forum would quickly start me off!

Use the server for all your work. With just 2G of RAM the local computer should only be used to access the server.

I am going to point you to a guide about how to use bowtie2: http://homer.salk.edu/homer/basicTutorial/mapping.html.

You will need a multi-fasta formatted file for your virus sequences (blast db files are not usable).

Broad steps:

1. Create an index for your virus sequences (bowtie2-build). This is what you are going to search against.

$ /path_to/bowtie2-build virus.fa VIR

VIR would become the "basename" for the bowtie2 index.

2. Start with trimmed/qc'ed fastq data.
3. Do the alignments (bowtie2) and save results in sam format file.

Single-end reads

$ /path_to/bowtie2 -p 2 -x VIR -U sample1_file.fastq -S sample1.sam

Paired-end reads

$ /path_to/bowtie2 -p 2 -x VIR -1 sample1_R1_file.fastq -2 sample1_R2_file.fastq -S sample1.sam

-p 2 is number of cores used for search. Keep to <= 4 for now. Provide "basename" (VIR) for index for -x option. Do not include file extensions.

4. Use samtools to "view/sort/index" sam file to bam format.
5. Evaluate the bam file.

[kaps]

Installed RAM IS 2 GB.
I have access to a unix server.
There are a number of bowtie modules installed already( the latest is bowtie2/2.2.5). Trying to read through the Bowtie manual so that I try analysis on the server. A quick guide from you or any other member on the forum would quickly start me off!

[GenoMax]

How can I install and run bowtie on a 32 bit windows computer?

You can't directly install/run bowtie2 on windows. You will have to use a unix like environment (cygwin) or a virtual machine running linux. Both options would encounter limits on a 32-bit machine because of amount of memory programs can use (how much RAM do you have?) and the size of NGS datasets.

Do you have access to a unix server (through your university/company)? It may be much better to do this type of analysis there.

[kaps]

How can I install and run bowtie on a 32 bit windows computer?

[zillur]

Thank you very for your kind reply. I have installed all the smalls/bcftools pipeline approximately 3 months ago. I think at that time these were latest. I have no idea about any update.

Best Regards
Zillur

[GenoMax]

Something does not appear to be right (are you using the correct genome).

531380 (0.86%) aligned exactly 1 time
16490453 (26.84%) aligned >1 times
27.70% overall alignment rate

Are you using new version of *ALL* programs (samtools/bcftools) in this pipeline?

BTW: Please create new threads for new questions. Your question is not related to the original thread.

[zillur]

Hi,
Sorry to disturb you again. I am facing problem again. Would you please to give some hints what is my faults? I have downloaded data from http://www.ebi.ac.uk/ena/data/search...genome+pair+en
May be there is a problem in creating egf.raw.bcf file. But I did it many with same protocol.

Best Regards
Zillur

Zillur-Rahman:1:26:2015 ZILLURRAHMAN$ bowtie2 -x ../genome -1 err029139_1.fastq -2 err029139_2.fastq -S eg.sam
30723562 reads; of these:
30723562 (100.00%) were paired; of these:
30723562 (100.00%) aligned concordantly 0 times
0 (0.00%) aligned concordantly exactly 1 time
0 (0.00%) aligned concordantly >1 times
----
30723562 pairs aligned concordantly 0 times; of these:
0 (0.00%) aligned discordantly 1 time
----
30723562 pairs aligned 0 times concordantly or discordantly; of these:
61447124 mates make up the pairs; of these:
44425291 (72.30%) aligned 0 times
531380 (0.86%) aligned exactly 1 time
16490453 (26.84%) aligned >1 times
27.70% overall alignment rate
Zillur-Rahman:1:26:2015 ZILLURRAHMAN$ samtools view -bS eg.sam > eg.bam
[W::sam_hdr_parse] duplicated sequence 'I'
[W::sam_hdr_parse] duplicated sequence 'VI'
[W::sam_hdr_parse] duplicated sequence 'III'
[W::sam_hdr_parse] duplicated sequence 'IX'
[W::sam_hdr_parse] duplicated sequence 'VIII'
[W::sam_hdr_parse] duplicated sequence 'V'
[W::sam_hdr_parse] duplicated sequence 'XI'
[W::sam_hdr_parse] duplicated sequence 'X'
[W::sam_hdr_parse] duplicated sequence 'XIV'
[W::sam_hdr_parse] duplicated sequence 'II'
[W::sam_hdr_parse] duplicated sequence 'XIII'
[W::sam_hdr_parse] duplicated sequence 'XVI'
[W::sam_hdr_parse] duplicated sequence 'XII'
[W::sam_hdr_parse] duplicated sequence 'VII'
[W::sam_hdr_parse] duplicated sequence 'XV'
[W::sam_hdr_parse] duplicated sequence 'IV'
Zillur-Rahman:1:26:2015 ZILLURRAHMAN$ samtools sort eg.bam eg.sorted
[bam_sort_core] merging from 26 files...
Zillur-Rahman:1:26:2015 ZILLURRAHMAN$ samtools mpileup -uf../genome eg.sorted.bam | bcftools view -o - > eg.raw.bcf
[fai_load] build FASTA index.
[fai_build] fail to open the FASTA file ../genome
[fai_load] fail to open FASTA index.
[vcf.c:1224 vcf_hdr_read] Could not read the header
Failed to open or the file not indexed: -
Zillur-Rahman:1:26:2015 ZILLURRAHMAN$ samtools mpileup -uf../genome.fa eg.sorted.bam | bcftools view -o - > eg.raw.bcf
[mpileup] 1 samples in 1 input files
<mpileup> Set max per-file depth to 8000
Zillur-Rahman:1:26:2015 ZILLURRAHMAN$ bcftools stats eg.raw.bcf
# This file was produced by bcftools stats (1.1+htslib-1.1) and can be plotted using plot-vcfstats.
# The command line was: bcftools stats eg.raw.bcf
#
# Definition of sets:
# ID [2]id [3]tab-separated file names
ID 0 eg.raw.bcf
# SN, Summary numbers:
# SN [2]id [3]key [4]value
SN 0 number of samples: 1
SN 0 number of records: 0
SN 0 number of SNPs: 0
SN 0 number of MNPs: 0
SN 0 number of indels: 0
SN 0 number of others: 0
SN 0 number of multiallelic sites: 0
SN 0 number of multiallelic SNP sites: 0
# TSTV, transitions/transversions:
# TSTV [2]id [3]ts [4]tv [5]ts/tv [6]ts (1st ALT) [7]tv (1st ALT) [8]ts/tv (1st ALT)
TSTV 0 0 0 0.00 0 0 0.00
# Sis, Singleton stats:
# SiS [2]id [3]allele count [4]number of SNPs [5]number of transitions [6]number of transversions [7]number of indels [8]repeat-consistent [9]repeat-inconsistent [10]not applicable
SiS 0 1 0 0 0 0 0 0 0
# AF, Stats by non-reference allele frequency:
# AF [2]id [3]allele frequency [4]number of SNPs [5]number of transitions [6]number of transversions [7]number of indels [8]repeat-consistent [9]repeat-inconsistent [10]not applicable
# QUAL, Stats by quality:
# QUAL [2]id [3]Quality [4]number of SNPs [5]number of transitions (1st ALT) [6]number of transversions (1st ALT) [7]number of indels
# IDD, InDel distribution:
# IDD [2]id [3]length (deletions negative) [4]count
# ST, Substitution types:
# ST [2]id [3]type [4]count
ST 0 A>C 0
ST 0 A>G 0
ST 0 A>T 0
ST 0 C>A 0
ST 0 C>G 0
ST 0 C>T 0
ST 0 G>A 0
ST 0 G>C 0
ST 0 G>T 0
ST 0 T>A 0
ST 0 T>C 0
ST 0 T>G 0
Zillur-Rahman:1:26:2015 ZILLURRAHMAN$ samtools mpileup -uf ../genome.fa eg.sorted.bam | bcftools view -o - > eg.raw.bcf
[mpileup] 1 samples in 1 input files
<mpileup> Set max per-file depth to 8000
Zillur-Rahman:1:26:2015 ZILLURRAHMAN$ samtools mpileup -uf genome.fa eg.sorted.bam | bcftools view -o u -v -c > eg.raw.bcf
[fai_load] build FASTA index.
[fai_build] fail to open the FASTA file genome.fa
[fai_load] fail to open FASTA index.
[vcf.c:1224 vcf_hdr_read] Could not read the header
Failed to open or the file not indexed: -
Zillur-Rahman:1:26:2015 ZILLURRAHMAN$ samtools mpileup -uf ../genome.fa eg.sorted.bam | bcftools view -o u -v -c > eg.raw.bcf
[mpileup] 1 samples in 1 input files
<mpileup> Set max per-file depth to 8000
[E::-c] unknown type
Zillur-Rahman:1:26:2015 ZILLURRAHMAN$ ls
ERR029139_1.fastq ERR029139_2.fastq eg.bam eg.sam
ERR029139_1.fastq.gz ERR029139_2.fastq.gz eg.raw.bcf eg.sorted.bam
Zillur-Rahman:1:26:2015 ZILLURRAHMAN$ bcftools stats eg.raw.bcf
[vcf.c:1224 vcf_hdr_read] Could not read the header
Could not read the file or the file is not indexed: eg.raw.bcf
Zillur-Rahman:1:26:2015 ZILLURRAHMAN$

[GenoMax]

Hi,
Thank you very much for your kind help. I need to try mapping paired reads to the genome, instead of single reads. Can you give me some hints from where I can download fastq files of yeast genome for pair reads mapping. Currently I am using http://www.ebi.ac.uk/ena/data/view/ERP000001
But there are only single reads.

Best Regards
Zillur

http://sra.dnanexus.com/?result_type=Study&show=&q=paired+end+yeast

You should post these kinds of questions in a new thread. This is no longer related to the parent thread you are posting in.

[zillur]

Hi,
Thank you very much for your kind help. I need to try mapping paired reads to the genome, instead of single reads. Can you give me some hints from where I can download fastq files of yeast genome for pair reads mapping. Currently I am using http://www.ebi.ac.uk/ena/data/view/ERP000001
But there are only single reads.

Best Regards
Zillur

[zillur]

Thank you very much. I think its working now.

Zillur-Rahman:index_err000004 ZILLURRAHMAN$ bowtie2-inspect -a index genome

It gave a single file

ATTAGTGTATTGGATTCGACAAGAGGCAAGCAAGGGAGCCAAGTTTTCCGCATGTCTGGAAGGCAGATCAAAGAGTTGTATTATAAAGTATGGAGCAACTTGCGTGAATCGAAGACAGAGGTGCTGCAGTACTTTTTGAACTGGGACGAGAAAAAGTGCCGGGAAGAATGGGAGGCAAAAGACGATACGGTCTTTGTGGAAGCGCTCGAGAAAGTTGGAGTTTTTCAGCGTTTGCGTTCCATGACGAGCGCTGGACTGCAGGGTCCGCAGTACGTCAAGCTGCAGTTTAGCAGGCATCATCGACAGTTGAGGAGCAGATATGAATTAAGTCTAGGAATGCACTTGCGAGATCAGCTTGCGCTGGGAGTTACCCCATCTAAAGTGCCGCATTGGACGGCATTCCTGTCGATGCTGATAGGGCTGTTCTACAATAAAACATTTCGGCAGAAACTGGAATATCTTTTGGAGCAGATTTCGGAGGTGTGGTTGTTACCACATTGGCTTGATTTGGCAAACGTTGAAGTTCTCGCTGCAGATAACACGAGGGTACCGCTGTACATGCTGATGGTAGCGGTTCACAAAGAGCTGGATAGCGATGATGTTCCAGACGGTAGATTTGATATAATATTACTATGTAGAGATTCGAGCAGAGAAGTTGGAGAGTGAAGGAAATTGTTGTTACGAAAGTCAGTGATTATGTATTGTGTAGTATAGTATATTGTAAGAAANNNNNNNNNCTAGGGAATATGCGTTTTGATGTAGTAGTATTTCACTGTTTTGATTTAGTGTTTGTTGCACGGCAGTAGCGAGAGACAAGTGGGAAAGAGTAGGATAAAAAGACAATCTATAAAAAGTAAACATAAAATAAAGGTAGTAAGTAGCTTTTGG

....and many more.......

[GenoMax]

You need to provide a name that will be used as the prefix for all index related files. This can be anything but you would want to use something (e.g. MyYeast) that would make sense afterwards.