Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • CS Student
    Member
    • Apr 2011
    • 20

    #bases & # reads

    Hi,

    I am new to bioinformatics and appreciate your help answering this question.

    I have a reads file [a sample is attached] and want to count the number of #bases and number of reads in this file, how do I do this? Is there a relation between the #bases and # reads in a reads file? i,e if the #bases information is available for a particular reads file, can I immediately calculate the number of reads?


    Thanks.
    Attached Files
  • chadn737
    Senior Member
    • Jan 2009
    • 392

    #2
    Assuming that all the reads are of a uniform length and have not been modified in some way (trimmed), then each read will be the same number of bases.

    In your sample fastq file:
    HTML Code:
    @SRR019388.1.1 SLXA-EAS1_126_FC20H6L_0_7_1_490_23.1 length=35
    GTCAAATATAGTGAGTACAGGAAAATAGGTGGAGA
    +SRR019388.1.1 SLXA-EAS1_126_FC20H6L_0_7_1_490_23.1 length=35
    <<<<<<<<<<<<;<<<<<<<<<<<<<<9<<;;7<;
    So your reads are 35bps long. If you know the number of reads just multiple by 35 and that equals the number of bases.

    Comment

    • westerman
      Rick Westerman
      • Jun 2008
      • 1104

      #3
      Originally posted by CS Student View Post
      Hi,

      I am new to bioinformatics and appreciate your help answering this question.

      I have a reads file [a sample is attached] and want to count the number of #bases and number of reads in this file, how do I do this? Is there a relation between the #bases and # reads in a reads file? i,e if the #bases information is available for a particular reads file, can I immediately calculate the number of reads?


      Thanks.
      There are several programs (e.g., get_fasta_stats -- search the forum for them) that will calculate read/base stats. You could also 'wc -l' the fastQ file and divide by 4 for the number of reads. Bases are bit more difficult to find via simple unix tools. Basically I suggest you do more reading and searching in the forum. Always a good way to find out information.

      There is no relation between #bases and #reads.

      Comment

      • westerman
        Rick Westerman
        • Jun 2008
        • 1104

        #4
        Originally posted by chadn737 View Post
        Assuming that all the reads are of a uniform length and have not been modified in some way (trimmed), then each read will be the same number of bases.
        And that is a big assumption. Sure, you could look at the start of the file and at the end of the file and see reads being 35 bases in length ... but are all? I wouldn't want to guarantee this on an unknown file.

        Actually from the sample file, 'CS student' should be able to figure out how many reads and the length of the reads (since this is given) via simple unix tools --- which any CS student should know. I'd use 'grep', 'cut', 'sort', and 'uniq'.

        Comment

        • GenoMax
          Senior Member
          • Feb 2008
          • 7142

          #5
          Originally posted by westerman View Post

          Actually from the sample file, 'CS student' should be able to figure out how many reads and the length of the reads (since this is given) via simple unix tools --- which any CS student should know. I'd use 'grep', 'cut', 'sort', and 'uniq'.
          Perhaps "CS Student" needs help understanding the "fastq" file format to follow your suggestion. May be a true beginner (can't tell from looking at "CS Student's" posting history).

          Comment

          • CS Student
            Member
            • Apr 2011
            • 20

            #6
            Thank you very much for your explainations. This is all what I wanted to know about # reads and #bases.

            Comment

            Latest Articles

            Collapse

            • SEQadmin2
              Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
              by SEQadmin2


              Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

              The systematic characterization of the human proteome has
              ...
              07-20-2026, 11:48 AM
            • SEQadmin2
              Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
              by SEQadmin2



              Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
              ...
              07-09-2026, 11:10 AM
            • SEQadmin2
              Cancer Drug Resistance: The Lingering Barrier to Rising Survival
              by SEQadmin2



              Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

              There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
              07-08-2026, 05:17 AM

            ad_right_rmr

            Collapse

            News

            Collapse

            Topics Statistics Last Post
            Started by SEQadmin2, 07-24-2026, 12:17 PM
            0 responses
            25 views
            0 reactions
            Last Post SEQadmin2  
            Started by SEQadmin2, 07-23-2026, 11:41 AM
            0 responses
            19 views
            0 reactions
            Last Post SEQadmin2  
            Started by SEQadmin2, 07-20-2026, 11:10 AM
            0 responses
            26 views
            0 reactions
            Last Post SEQadmin2  
            Started by SEQadmin2, 07-13-2026, 10:26 AM
            0 responses
            38 views
            0 reactions
            Last Post SEQadmin2  
            Working...