Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • Dario1984
    Senior Member
    • Jun 2011
    • 166

    #16
    Originally posted by GenoMax View Post
    Isaac (http://bioinformatics.oxfordjournals...ent/29/16/2041) was possibly designed for human data but should be usable for other genomes. Illumina has released pre-built indexes only for Hg19 but indexes can be built for other genomes (I have not tried it yet). Isaac aligner in HAS uses 32-mer seeds.
    Another PhD student discovered it doesn't work for the sheep genome, which has | in the name of chromosomes.

    e.g.

    >gi|406684590|gb|CM001582.1| Ovis aries breed Texel chromosome 1, whole genome shotgun sequence
    ATGGGGACATGACCGGGAGGTGGGCAAGGAGAGCGTCTACAGCTCAGGGGAGCCAGGGATCACCGCTCCC ...

    I don't see the point of variant calling for a draft genome, though.

    Comment

    • colindaven
      Senior Member
      • Oct 2008
      • 417

      #17
      So is anyone using Phi in bioinformatics these days ? We do have a great number of compute bound processes (blastx, blastx) in a productive pipeline which could be sped up.

      I do wonder about the utility for typical IO and memory bound bioinformatics applications such as NGS though.

      Comment

      • westerman
        Rick Westerman
        • Jun 2008
        • 1104

        #18
        Originally posted by colindaven View Post
        So is anyone using Phi in bioinformatics these days ? We do have a great number of compute bound processes (blastx, blastx) in a productive pipeline which could be sped up.

        I do wonder about the utility for typical IO and memory bound bioinformatics applications such as NGS though.
        I haven't found a good use for the Phi co-processor. As you imply -- IO and memory bound problems are not a good match.

        Comment

        Latest Articles

        Collapse

        • SEQadmin2
          From Collection to Sequencing: Why Sample Preparation and Preservation Define Sequencing Data
          by SEQadmin2


          Data variability is still an issue in sequencing technologies despite the advances in reproducibility and accuracy of these platforms. But the problem does not originate in the sequencing itself, but in the previous steps, before the sample reaches the sequencer.


          The first step is collection, followed by preservation and sample preparation for analysis. Most scientists overlook those steps, but not being careful might just be skewing the experiment’s results.
          ...
          06-02-2026, 10:05 AM
        • SEQadmin2
          Single-Cell Sequencing at an Inflection Point: Early Impacts of New Platforms and Emerging Trends
          by SEQadmin2


          With the launch of new single-cell sequencing platforms in 2026, the field stands at an exciting inflection point. This article surveys the most impactful advances in the field and discusses how they’re reshaping research in cancer, immunology, and beyond.


          Introduction

          Single-cell sequencing technologies have undergone remarkable advances over the past decade, transitioning from low-throughput experimental approaches to highly scalable platforms capable of...
          05-22-2026, 06:42 AM
        • SEQadmin2
          Environmental Genomics in the Age of NGS: From Microbes to Conservation Strategies
          by SEQadmin2

          Studying ecosystems means dealing with complex, multi-species communities that are hard to observe at scale. This complexity, however, hides many important questions to be answered, from how biogeochemical cycles work and how climate change can affect species distribution to how conservation strategies can work best.


          Genomics, particularly since the expansion of NGS, has transformed ecosystem ecology. By sequencing environmental DNA, we can now assess biodiversity without direct...
          05-06-2026, 09:04 AM

        ad_right_rmr

        Collapse

        News

        Collapse

        Topics Statistics Last Post
        Started by SEQadmin2, Yesterday, 08:59 AM
        0 responses
        14 views
        0 reactions
        Last Post SEQadmin2  
        Started by SEQadmin2, 06-02-2026, 12:03 PM
        0 responses
        22 views
        0 reactions
        Last Post SEQadmin2  
        Started by SEQadmin2, 06-02-2026, 11:40 AM
        0 responses
        19 views
        0 reactions
        Last Post SEQadmin2  
        Started by SEQadmin2, 05-28-2026, 11:40 AM
        0 responses
        32 views
        0 reactions
        Last Post SEQadmin2  
        Working...