Unconfigured Ad

Collapse
X
Collapse
 
  • Page of 1
  • Filter
  • Time
  • Show
Clear All
new posts
Previous template Next
  • sspang
    Junior Member
    • Jul 2012
    • 1
    #1

    data format

    Hi guys,

    I am a totally beginner of deep seq. I can not figure out what my fastq format is. Could anyone tell me what it is and why? Thank you!

    my data:
    @HWI-ST550_0193:3:1101:1102:2141#ACTGAT/1
    GNTCTTTGTTGTATTGAAATTAGCGTATTTGTTGGATATCTTGCCTCAAA
    +HWI-ST550_0193:3:1101:1102:2141#ACTGAT/1
    _BP\cccegggggfhigdgghceefgffhhiihhibffg^cgfaffcefh

    shan
    Tags: None
  • dariober
    Senior Member
    • May 2010
    • 311
    #2
    Hi- There's a Wikipedia entry for FASTQ format (http://en.wikipedia.org/wiki/FASTQ_format). About quality encoding, I guess the read you have posted is Illumina >1.3 since you have up to the character i which should be unlikely in Sanger encoding.

    Comment

    Previous template Next

    Latest Articles

    Collapse
    • SEQadmin2
      Nine Things a Sample Prep Scientist Thinks About Before Sequencing
      by SEQadmin2


      I’m not a sequencing expert. I’m a purification scientist who uses NGS to evaluate workflows my group develops. With this perspective, we think about the sample first and the NGS workflow second. The sequencer is an exceptionally honest reporter, but it can only report on what you give it, so whether you get clean, interpretable data from an NGS workflow is largely determined before you begin.

      Here are nine questions we think about, in roughly the order they matter, before...
      06-18-2026, 07:11 AM
    • SEQadmin2
      From Collection to Sequencing: Why Sample Preparation and Preservation Define Sequencing Data
      by SEQadmin2


      Data variability is still an issue in sequencing technologies despite the advances in reproducibility and accuracy of these platforms. But the problem does not originate in the sequencing itself, but in the previous steps, before the sample reaches the sequencer.

      The first step is collection, followed by preservation and sample preparation for analysis. Most scientists overlook those steps, but not being careful might just be skewing the experiment’s results.
      ...
      06-02-2026, 10:05 AM
    View All

    ad_right_rmr

    Collapse

    News

    Collapse
    Topics Statistics Last Post
    Whole-Genome Sequencing Traces Faroe Islands Ancestry to a North Atlantic Founder Population by SEQadmin2
    Started by SEQadmin2, 06-17-2026, 06:09 AM
    0 responses
    31 views
    0 reactions
    		 Last Post SEQadmin2
    by SEQadmin2
    06-17-2026, 06:09 AM  
    Sequencing the Two-Toed Sloth Genome Reveals Jumping Genes Tied to Its Extreme Metabolism by SEQadmin2
    Started by SEQadmin2, 06-09-2026, 11:58 AM
    0 responses
    96 views
    0 reactions
    		 Last Post SEQadmin2
    by SEQadmin2
    06-09-2026, 11:58 AM  
    A New Method Makes Hantavirus Genome Analysis Faster and More Accessible by SEQadmin2
    Started by SEQadmin2, 06-05-2026, 10:09 AM
    0 responses
    117 views
    0 reactions
    		 Last Post SEQadmin2
    by SEQadmin2
    06-05-2026, 10:09 AM  
    A New Single-Cell Method Maps DNA-Protein Interactions by SEQadmin2
    Started by SEQadmin2, 06-04-2026, 08:59 AM
    0 responses
    109 views
    0 reactions
    		 Last Post SEQadmin2
    by SEQadmin2
    06-04-2026, 08:59 AM  
    View All
    Working...