Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • chandubobby@yahoo.co.in
    Junior Member
    • Nov 2009
    • 6

    #1

    Solexa/helicos

    Hi all,

    I am graduate student from New York working on a project related to assembler. In order to get idea of how things work in assembler, I download velvet and i am trying to run it on different data types such as ABI solid, Helicos and Solexa.
    I ran ABI solid on velvet and it worked. However, I didn't find solexa and Helicos data from the net. Could anyone upload some test data w.r.t Helicos, Solexa or point me to the right place from where i can download some sample data to run it in velvet.

    Thanks,
    Chandu
  • Xi Wang
    Senior Member
    • Oct 2009
    • 317

    #2
    Originally posted by [email protected] View Post
    Hi all,

    I am graduate student from New York working on a project related to assembler. In order to get idea of how things work in assembler, I download velvet and i am trying to run it on different data types such as ABI solid, Helicos and Solexa.
    I ran ABI solid on velvet and it worked. However, I didn't find solexa and Helicos data from the net. Could anyone upload some test data w.r.t Helicos, Solexa or point me to the right place from where i can download some sample data to run it in velvet.

    Thanks,
    Chandu
    There are lots of resources on the website of NCBI:


    The Sequence Read Archive (SRA) stores sequencing data from the next generation of sequencing platforms including Roche 454 GS System®, Illumina Genome Analyzer®, Applied Biosystems SOLiD® System, Helicos Heliscope®, and others.

    For example, you can get the sequencing data of an illumina run through:
    ftp://ftp.ncbi.nlm.nih.gov/sra/static/SRX003/SRX003935/

    Hope this info helps.
    Xi
    Xi Wang

    Comment

    • chandubobby@yahoo.co.in
      Junior Member
      • Nov 2009
      • 6

      #3
      Regarding change of file formats..!!

      Thanks for the reply..The solexa data was helpful..

      On a separate note, I have some more questions..

      1. I couldn't find helicos data in the above links...Could you please help with this..??
      2. One more question is regarding the change of file formats (from solexa to fasta, from helicos to fasta).. Are there any scripts or tools for this? If yes, could you please point me to those resources or links..??

      Thanks,
      Chandu

      Comment

      • steven
        Senior Member
        • Aug 2009
        • 269

        #4
        Chandu,
        You'll find Helicos datasets here (just need to open an account) or there. It's already in fasta format.
        cheers,
        s.

        Comment

        • chandubobby@yahoo.co.in
          Junior Member
          • Nov 2009
          • 6

          #5
          Steven,

          Thanks a lot for the helicos data..

          I have some more data which has to be converted to fasta format..So I need a converter or some scripts which basically converts from different formats to fasta format.. could you please help me on this conversion part..??

          Thanks,
          Chandu

          Comment

          • Xi Wang
            Senior Member
            • Oct 2009
            • 317

            #6
            Originally posted by [email protected] View Post
            Steven,

            Thanks a lot for the helicos data..

            I have some more data which has to be converted to fasta format..So I need a converter or some scripts which basically converts from different formats to fasta format.. could you please help me on this conversion part..??

            Thanks,
            Chandu

            What is the format of the data you already have? Could you please paste a head of the data here?
            Xi Wang

            Comment

            • steven
              Senior Member
              • Aug 2009
              • 269

              #7
              If the answer is not in a previous threads (like this one or this one), i would suggest to open a new thread with a relevant title, specifying the formats you want to convert into fasta.
              cheers,
              s.

              Comment

              • chandubobby@yahoo.co.in
                Junior Member
                • Nov 2009
                • 6

                #8
                @xi

                This is a first 10 lines of fastq file....I downloaded it from the net..this has to converted to fasta file..

                @SRR015348.1 HWUSI-BETA8_3:8:1:441:264 length=32
                AACGGACCCCTTCACTCTGGCCTCCTGTAGGT
                +SRR015348.1 HWUSI-BETA8_3:8:1:441:264 length=32
                YYYYYYYYYYYYYYYYYYYYYYYYYYYYYYTQ
                @SRR015348.2 HWUSI-BETA8_3:8:1:861:561 length=32
                ATCATCTCTGCCCCCTCTGCTGATGCCCCCAT
                +SRR015348.2 HWUSI-BETA8_3:8:1:861:561 length=32
                YYYYYYYYYYYYYYYYYYYYYYYYYYYYYYQQ
                @SRR015348.3 HWUSI-BETA8_3:8:1:687:253 length=32
                ACCTGCAGAGGCTCATCTTTGCAGGCAAGCAG
                ..........................................................................................

                @Steven

                I tried running the script which u mentioned with the following command
                "perl script.pl SRR015348.fastq SRR015348.fasta"

                it throws error saying that "No such file or directory at script.pl line 3, <> line 10600168"..

                Iam giving the path correctly..But still it showing up the above error after executing the script for some 30-40 secs...


                Thanks,
                Chandu

                Comment

                • Xi Wang
                  Senior Member
                  • Oct 2009
                  • 317

                  #9
                  Hi Chandu,

                  i find there is a script to convert fastq to fasta:


                  i think you can check this script first. hope it works.
                  Xi Wang

                  Comment

                  • chandubobby@yahoo.co.in
                    Junior Member
                    • Nov 2009
                    • 6

                    #10
                    @Xi

                    Thanks for the script..

                    I tried running the script using the following command..

                    perl fastq2fasta.pl xyz.fastq

                    It ran for couple of minutes.... and terminated successfully..

                    My question is .. Will it generate a new fasta file from fastq file..?? or will it convert fastq to fasta itself..??

                    I tried checking old and new fastq files after running the script...there is no difference..

                    And one more doubt is how can i identify fastq and fasta files..??

                    Please help on this..

                    Thanks,
                    Chandu

                    Comment

                    • ECO
                      --Site Admin--
                      • Oct 2007
                      • 1360

                      #11
                      Originally posted by [email protected] View Post
                      @Xi

                      Thanks for the script..

                      I tried running the script using the following command..

                      perl fastq2fasta.pl xyz.fastq

                      It ran for couple of minutes.... and terminated successfully..

                      My question is .. Will it generate a new fasta file from fastq file..?? or will it convert fastq to fasta itself..??

                      I tried checking old and new fastq files after running the script...there is no difference..

                      And one more doubt is how can i identify fastq and fasta files..??

                      Please help on this..

                      Thanks,
                      Chandu
                      You need to capture its output in a file, as it's just printing to stdout. Try this:

                      Code:
                      perl fastq2fasta.pl xyz.fastq > xyz.fasta

                      Comment

                      • chandubobby@yahoo.co.in
                        Junior Member
                        • Nov 2009
                        • 6

                        #12
                        I didn't notice that..

                        Thanks a lot

                        Chandu

                        Comment

                        • sundar suku
                          Junior Member
                          • Mar 2010
                          • 1

                          #13
                          Help me on velvet

                          Hi all,

                          I am having some doubts regarding velvet :

                          I am just a beginner to velvet. I couldn't able to understand of differentiate shortPaired,short2,longPaired.

                          What are all the parameters are neccessary to run properly?

                          I would be wonder if any one of u peoples help me in this,

                          Thanks all..............

                          Comment

                          • labunit
                            Member
                            • Sep 2010
                            • 10

                            #14
                            I don't know wether there is still any demand to know an easy way to convert from fastq to fasta but here it is anyway:

                            Code:
                            egrep -A 1 "^@" file.fastq | tr "@" ">" | egrep -v "\-\-" > file.fasta
                            The first part greps the lines beginning with @ plus the next line (-A 1) which is the line containing the read. The next part translates the "@" into an ">" to comply with the fasta format. The final part greps (-v: inverted grep) only the relevant lines for the output file. Without the last part annoying lines containing "--" would appear in the fasta-file.

                            Comment

                            Latest Articles

                            Collapse

                            • SEQadmin2
                              Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
                              by SEQadmin2



                              CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

                              Despite this, “CRISPR helped turn genome editing from a specialized technique into
                              ...
                              07-31-2026, 11:01 AM
                            • SEQadmin2
                              Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                              by SEQadmin2


                              Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                              The systematic characterization of the human proteome has
                              ...
                              07-20-2026, 11:48 AM
                            • SEQadmin2
                              Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                              by SEQadmin2



                              Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                              ...
                              07-09-2026, 11:10 AM

                            ad_right_rmr

                            Collapse

                            News

                            Collapse

                            Topics Statistics Last Post
                            Started by SEQadmin2, Today, 07:41 AM
                            0 responses
                            9 views
                            0 reactions
                            Last Post SEQadmin2  
                            Started by SEQadmin2, 08-03-2026, 10:13 AM
                            0 responses
                            21 views
                            0 reactions
                            Last Post SEQadmin2  
                            Started by SEQadmin2, 07-31-2026, 02:55 AM
                            0 responses
                            35 views
                            0 reactions
                            Last Post SEQadmin2  
                            Started by SEQadmin2, 07-24-2026, 12:17 PM
                            0 responses
                            25 views
                            0 reactions
                            Last Post SEQadmin2  
                            Working...