Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • beeman
    Member
    • May 2012
    • 20

    #1

    Converting fastq formats?

    First post, so please be gentle

    I've looked for the answer in faq's and related posts, but I'm still stumped.

    I have a number of PE illumina datasets in fastq format, however I've recently downloaded a new dataset which appears to have a substantially different format for it's fastq header/identifiers. I'd like to use this new dataset in some established pipelines that don't seem to be happy with this different format.

    Firstly, can someone please explain what may be the underlying cause of this? Could this arise due to different technologies or merely different revisions of the standard pipelines over time?

    Secondly, is it possible to use any tools like Biopython to reformat the header/identifiers to a more acceptable format?


    Example of old *working* fastq data compatible with our pipeline

    --------
    @SRR094905.1 HWI-BRUNOP20X:0617:2:1:12498:1196 length=75
    TATAAGATAATGTTTAATAAAAAANNNNNNNNNNNNNNNAGNNNNNNNNNNNTNNNNTTTTGTNNNNNNNNGAGG
    +SRR094905.1 HWI-BRUNOP20X:0617:2:1:12498:1196 length=75
    FFFFDFFFFEFEFFFFFFFF####!!!!!!!!!!!!!!!##!!!!!!!!!!!#!!!!######!!!!!!!!####
    @SRR094905.2 HWI-BRUNOP20X:0617:2:1:5633:1197 length=75
    AATATTTTTTATGATGGTAGAATANNNNNNNNNNNNNNNTGNNNNNNNNNNNTNNNNTTTATTNNNNNNNNGAGT
    +SRR094905.2 HWI-BRUNOP20X:0617:2:1:5633:1197 length=75
    HHHHHHHHEEEEEHHHHGHH####!!!!!!!!!!!!!!!##!!!!!!!!!!!#!!!!######!!!!!!!!####
    @SRR094905.3 HWI-BRUNOP20X:0617:2:1:6241:1197 length=75
    GAGGGGGTTTTTATTGGTTTTAGGNNNNNNNNNNNNNNNTTNNNNNNNNNNNTNNNNATTTGTNNNNNNNNTTGT
    +SRR094905.3 HWI-BRUNOP20X:0617:2:1:6241:1197 length=75
    GFGGF=86=DFF;?@#########!!!!!!!!!!!!!!!##!!!!!!!!!!!#!!!!######!!!!!!!!####
    @SRR094905.4 HWI-BRUNOP20X:0617:2:1:6877:1197 length=75
    GGAGGTATTTTTTACGAGGTAGGGNNNNNNNNNNNNNNNTTNNNNNNNNNNNGNNNNTTAGGANTNNNNNNGTAG
    +SRR094905.4 HWI-BRUNOP20X:0617:2:1:6877:1197 length=75
    HHHHHGHHHHHGGGHHHHHG####!!!!!!!!!!!!!!!##!!!!!!!!!!!#!!!!######!#!!!!!!####
    @SRR094905.5 HWI-BRUNOP20X:0617:2:1:8302:1197 length=75
    TTTGTATTAGTTATTTTGGCGTGANNNNNNNNNNNNNNNTANNNNNNNNNNNGNNNNTTGGTTNNNNNNNNTTTT
    +SRR094905.5 HWI-BRUNOP20X:0617:2:1:8302:1197 length=75
    HHHHHHHHGHHHGHHHCCHHA@A#!!!!!!!!!!!!!!!##!!!!!!!!!!!#!!!!######!!!!!!!!####


    Example of *new* dataset with different headers/identifiers
    --------
    @A80PGJABXX:8:1:1648:2147#0/1
    AATAATAATTTATTTATATATTTATTTATTTATAAATTTATTTTTTAAA
    +
    ggggggfgggggggggggggggfggggggggdggadfbfegggggf_^a
    @A80PGJABXX:8:1:1639:2201#0/1
    ATGATGAATATTTTTTTGATTAAATTATGATTATATTTATGTATTTTGA
    +
    gggfgggggfgggbgggggggfgdgggggefgggggggegfeggefffa
    @A80PGJABXX:8:1:1546:2220#0/1
    TGTTATGTATTTATTAAGATAATATGATGAAAATTATAAAATATAATTA
    +
    fffff^^ffd^efdcdeeaecfefdecddfffNffeeadedfdffaffe
    @A80PGJABXX:8:1:1579:2244#0/1
    TAAGTTAGGGTGATTGTATATAATAATTTGTTTAAGGTGATAGTTATTA
    +
    effefedeee[dcddffcffgdfggggggggggeaddJd^dadcbbcfd
    @A80PGJABXX:8:1:1753:2142#0/1
    GAATTTTATAATATGGAATTTATTATATTTGAATAATGTAAGAGTTGAT
    +
    gfgggggeggggfggfgfgggdggdgegggfddggggfeaggdgfggeg


    Thanks in advance for your patience!
  • GenoMax
    Senior Member
    • Feb 2008
    • 7142

    #2
    Perhaps you missed the Wikipedia entry for FASTQ format.



    Am curious as to why your pipelines are not happy with the change in sequence ID. Are you parsing the ID's?
    Last edited by GenoMax; 05-28-2013, 03:42 AM.

    Comment

    • beeman
      Member
      • May 2012
      • 20

      #3
      Hi thanks for your reply.

      Yes I have read the fastq wiki, but the two fastq files appear to be annotated in a different way, hence my confusion.

      In the first fastq file the read ID is first (and increments for each read), followed by the instrument name "SRR094905.1 HWI-BRUNOP20X". For the second file, the first entry is the instrument name and is the same for every read, in line with the illumina format on the fastq wiki, rather than a unique read ID for each and every read.

      Does this make sense?

      I am unsure as to why there is such a significant difference in read annotation between these two datasets. Of course I can parse this information for each read and output to the required format, but I want to establish what is the "correct" and "proper" format that I should use, as despite the standard outlined in the wiki page there are obviously significant variations.

      Cheers,

      Comment

      • GenoMax
        Senior Member
        • Feb 2008
        • 7142

        #4
        Originally posted by beeman View Post
        Hi thanks for your reply.

        Yes I have read the fastq wiki, but the two fastq files appear to be annotated in a different way, hence my confusion.

        In the first fastq file the read ID is first (and increments for each read), followed by the instrument name "SRR094905.1 HWI-BRUNOP20X". For the second file, the first entry is the instrument name and is the same for every read, in line with the illumina format on the fastq wiki, rather than a unique read ID for each and every read.

        Does this make sense?
        The first data set appears to have come from SRA. As noted in the Wikipedia article SRA identifier is added to each original ID line.

        The second dataset you have seems to have originated from a sequencer.

        Originally posted by beeman View Post

        I am unsure as to why there is such a significant difference in read annotation between these two datasets. Of course I can parse this information for each read and output to the required format, but I want to establish what is the "correct" and "proper" format that I should use, as despite the standard outlined in the wiki page there are obviously significant variations.

        Cheers,
        There is no standard as to what there needs to be there on the ID line. Minimal FASTQ format only needs the following items

        Code:
        @SEQ_ID
        GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
        +
        !''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65

        Comment

        • beeman
          Member
          • May 2012
          • 20

          #5
          Ok thanks,

          Comment

          • HESmith
            Senior Member
            • Oct 2009
            • 512

            #6
            The "new" format is actually from an older version of the Illumina platform. Your pipeline may be unhappy b/c the quality scores are PHRED+64 encoded instead of the Sanger standard of PHRED+33.

            Comment

            • JackieBadger
              Senior Member
              • Mar 2009
              • 385

              #7
              If so, you can converts between PHRED encryptions using the Fastq groomer tool in Galaxy portal

              Comment

              • beeman
                Member
                • May 2012
                • 20

                #8
                Thanks for your helpful replies

                Comment

                Latest Articles

                Collapse

                • SEQadmin2
                  Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
                  by SEQadmin2



                  CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

                  Despite this, “CRISPR helped turn genome editing from a specialized technique into
                  ...
                  07-31-2026, 11:01 AM
                • SEQadmin2
                  Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                  by SEQadmin2


                  Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                  The systematic characterization of the human proteome has
                  ...
                  07-20-2026, 11:48 AM
                • SEQadmin2
                  Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                  by SEQadmin2



                  Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                  ...
                  07-09-2026, 11:10 AM

                ad_right_rmr

                Collapse

                News

                Collapse

                Topics Statistics Last Post
                Started by SEQadmin2, Yesterday, 10:13 AM
                0 responses
                13 views
                0 reactions
                Last Post SEQadmin2  
                Started by SEQadmin2, 07-31-2026, 02:55 AM
                0 responses
                27 views
                0 reactions
                Last Post SEQadmin2  
                Started by SEQadmin2, 07-24-2026, 12:17 PM
                0 responses
                20 views
                0 reactions
                Last Post SEQadmin2  
                Started by SEQadmin2, 07-23-2026, 11:41 AM
                0 responses
                19 views
                0 reactions
                Last Post SEQadmin2  
                Working...