Maybe galaxy has what you're looking for:
Or fastqc:
Or have a look at the wiki:
http://seqanswers.com/wiki/Special:B...uality_Control
-
Threshold quality score to determine the quality read of ILLUMINA reads problem
Hi,
Does anybody have idea regarding the general threshold average quality score to determine whether the ILLUMINA raw reads is good or bad quality?
Below is one of my ILLUMINA raw reads in fastq format:
@HWI-EAS001
AACATTCAACGCTGNCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC
+HWI-EAS001
^`Y^aa__^_]\`_B\U][RV`W`^`][``__Z^P[UUZZUUa^Z[^^Z[
The above reads got 50 nucleotide in length.
Is it got any program or script able to calculate the average quality score of above read?
My purpose is hope to calculate the average quality score of each read.
Based on the average quality score of each read, I plan to filter out those "low quality reads" that below threshold of average quality score.
Thanks a lot for any advice.
-
NGS has revolutionized clinical microbiology by offering new ways to identify and surveil pathogens without prior knowledge of the target. One popular approach is 16S rRNA and ITS amplicon sequencing, which targets specific microbial markers. But studies are increasingly incorporating shotgun metagenomics, a technique that sequences all DNA from a sample without targeting specific microbial markers. This approach allows more detailed taxonomic classification, detection...10-30-2026, 06:46 AM -
Tumors contain complex mixtures of cell populations that evolve in response to treatment and host-specific factors. Tissue biopsies provide only static snapshots of a tumor’s state. But what if we could follow that evolution over time using a minimally invasive technique?
Liquid biopsies can detect tumor-derived material circulating in the bloodstream, providing a way to study treatment response, detect emerging resistance, and discover new biomarkers. Circulating...10-14-2026, 09:55 AM
Leave a comment: