Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • Medhat
    Member
    • Jun 2013
    • 37

    PBSuite spots ambiguous insertion output value

    Hi,

    Originally I post this question in another place but I could not find an answer.

    I am using PBSuite version 15.8.24

    `Honey.py spots` was used to identify structure variations.

    here is one line of the output showing insertion, my question is: the insertion should be in one point in the genome, so how the output contains start and end ? (does the software add the size to satrt point to find the end point? is there a shift in all genome based on that)


    1 1211650 1211854 INS 353 zscore=-11.943;szMean=353.000;sz3rdQ=550.000;szCount=5.000;strandCnt=2,3;szMedian=547.000;groupName=1;coverage=14.000;sz1stQ=60.000;mqfilt=0.000
    also I visited similar question in https://sourceforge.net/p/pb-jelly/d...read/9b263cf1/

    but the output in this post is;

    lambda_NEB3011 29999 29999 INS 86 zscore=-15.744;GT=1/1;seq=ATTTTCACAAGCGTTATCTTTTACAAAACCGATCTCACTCTCCTTTGATGCGAATGCCAGCGTCAGACATCATATGCAGATACTCA;szMean=89.000;szCount=16.000;sz3rdQ=96.000;consensusCreated=1.000;strandCnt=7,9;szMedian=90.000;groupName=lambda_NEB3011;coverage=16.000;sz1stQ=78.000;mqfilt=0.000;GQ=7.321
    were the start and end point is the same `29999`.

    is there any explanation?

    Thanks
  • Markiyan
    Senior Member
    • Sep 2010
    • 126

    #2
    Some insetrions are flanked with duplication or deletion events...

    Quite a few insertional events (esp transposase induced are flanked by the target sequence duplication).
    In other cases it can be accompanied by the region deletion/replacement, so it would have both start and stop.

    PS: If you have enough reads coverage, assemble the sequences de novo and compare the region of interest in both assemblies using mummer/dotplot/(www)BLAST in master/slave mode.

    Also you can use raw read(s) spanning the region of interest and map them using BLAST/BLASR or similar alignment tool which is able to handle the raw pacbio error rate...

    Comment

    Latest Articles

    Collapse

    • SEQadmin2
      Nine Things a Sample Prep Scientist Thinks About Before Sequencing
      by SEQadmin2


      I’m not a sequencing expert. I’m a purification scientist who uses NGS to evaluate workflows my group develops. With this perspective, we think about the sample first and the NGS workflow second. The sequencer is an exceptionally honest reporter, but it can only report on what you give it, so whether you get clean, interpretable data from an NGS workflow is largely determined before you begin.


      Here are nine questions we think about, in roughly the order they matter, before...
      Yesterday, 07:11 AM
    • SEQadmin2
      From Collection to Sequencing: Why Sample Preparation and Preservation Define Sequencing Data
      by SEQadmin2


      Data variability is still an issue in sequencing technologies despite the advances in reproducibility and accuracy of these platforms. But the problem does not originate in the sequencing itself, but in the previous steps, before the sample reaches the sequencer.


      The first step is collection, followed by preservation and sample preparation for analysis. Most scientists overlook those steps, but not being careful might just be skewing the experiment’s results.
      ...
      06-02-2026, 10:05 AM
    • SEQadmin2
      Single-Cell Sequencing at an Inflection Point: Early Impacts of New Platforms and Emerging Trends
      by SEQadmin2


      With the launch of new single-cell sequencing platforms in 2026, the field stands at an exciting inflection point. This article surveys the most impactful advances in the field and discusses how they’re reshaping research in cancer, immunology, and beyond.


      Introduction

      Single-cell sequencing technologies have undergone remarkable advances over the past decade, transitioning from low-throughput experimental approaches to highly scalable platforms capable of...
      05-22-2026, 06:42 AM

    ad_right_rmr

    Collapse

    News

    Collapse

    Topics Statistics Last Post
    Started by SEQadmin2, 06-17-2026, 06:09 AM
    0 responses
    16 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 06-09-2026, 11:58 AM
    0 responses
    38 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 06-05-2026, 10:09 AM
    0 responses
    43 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 06-04-2026, 08:59 AM
    0 responses
    49 views
    0 reactions
    Last Post SEQadmin2  
    Working...