Tile is missing

[jmlabioinfo]

Hi all,

I received some fastq files from a PE HiSeq and when I tried to isolate N reads using the "fastq_illumina_reads -N" I got the following error:

Input error: file 'STDIN' line 1: Expecting Illumina-CASAVA1.8 ID line structure (@<instrument>:<run number>:<flowcell ID>:<lane>:<tile>:<x-pos>:<y-pos> <read>:<is filtered>:<control number>:<index sequence>) - got '@HS34_23148:4:1313:16347:42480/1' (Can't extract 'Tile’)



The header of the file shows:
@HS34_23148:4:2106:12625:73859/2
CACCAGCTGAGAGAGATGCTCGCCGTTGACTGACGAACTGAATTCCCAGTTCACGGCGGTATGGAATACCGTCGT
+
BBBBBFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF
@HS34_23148:4:1114:12855:77248/2
CTCGCCGTTGACTGACGAACTGAATTCCCAGTTCACGGCGGTATGGAATACCGTCGTCGCAGAGCTCAACGGTGA
+
BBBBBFFFFFFFFFFFFFFFFFFFBFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFBFFFFFFFFFFFFF
@HS34_23148:4:1311:2663:94744/2
CTCGACAGATATTGATTGTCGTCACCGTTGAGCTCTGCGACGACGGTATTCCATACCGCCGTGAACTGGGAATTC

Does anyone already get the same problem with the tile coordinates?
(I could ask the facility who sent me the files an explanation but I'm not sure if the problem come from me or not)

Thank you

[kmcarr]

Hi all,

I received some fastq files from a PE HiSeq and when I tried to isolate N reads using the "fastq_illumina_reads -N" I got the following error:

Input error: file 'STDIN' line 1: Expecting Illumina-CASAVA1.8 ID line structure (@<instrument>:<run number>:<flowcell ID>:<lane>:<tile>:<x-pos>:<y-pos> <read>:<is filtered>:<control number>:<index sequence>) - got '@HS34_23148:4:1313:16347:42480/1' (Can't extract 'Tile’)



The header of the file shows:
@HS34_23148:4:2106:12625:73859/2
CACCAGCTGAGAGAGATGCTCGCCGTTGACTGACGAACTGAATTCCCAGTTCACGGCGGTATGGAATACCGTCGT
+
BBBBBFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF
@HS34_23148:4:1114:12855:77248/2
CTCGCCGTTGACTGACGAACTGAATTCCCAGTTCACGGCGGTATGGAATACCGTCGTCGCAGAGCTCAACGGTGA
+
BBBBBFFFFFFFFFFFFFFFFFFFBFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFBFFFFFFFFFFFFF
@HS34_23148:4:1311:2663:94744/2
CTCGACAGATATTGATTGTCGTCACCGTTGAGCTCTGCGACGACGGTATTCCATACCGCCGTGAACTGGGAATTC

Does anyone already get the same problem with the tile coordinates?
(I could ask the facility who sent me the files an explanation but I'm not sure if the problem come from me or not)

Thank you

It looks like you got hold of a very old (in Illumina time scale) FastQ file. Have a look at the Illumina sequence identifiers discussion on the FastQ format Wikipedia page. The sequence headers in your file are the pre-CASAVA 1.8 format. The software you are trying to use (fastq_illumina_reads) is expecting the header format to be the post-CASAVA 1.8 format. I can't remember when that format version was first introduced but it was years ago.

What software package is the fastq_illumina_reads program from? Does it have a command line option to switch between the old and new FastQ sequence ID line formats?