[paa6]

@sklages I have two types of reads files one is in .sff format and other one is .qual format. First I tried to converted .qual into .fasta and performed assembly using geneious and velvet both software but contigs didnt generate.

After discussing my problem in this forum, I came to conclusion that .qual is not an illumina seuencer file (according to my supervisor). So now I have tried to import .sff file into geneious to perform assembly but geneious is showing error message.

[sklages]

@skladge can u provide me any research paper mentioning that to assembl the 454 u need all these formats...so that I can show him proof. He was telling me that .qual is an Illumina sequencing file and .sff is 454 sequencing. So, obviously if i will try to explain him that they both are the same file of 454 sequencing and I need additional files too...so, I need to show him research paper...

can you paste the first few lines of the *qual* file so that we can see what format you have?

What is the output of:

strings yourFile.sff | grep run_type
strings yourFile.sff | grep instrument_model

Both should help us to determine what kind of files you have.

[mastal]

@skladge can u provide me any research paper mentioning that to assembl the 454 u need all these formats...so that I can show him proof. He was telling me that .qual is an Illumina sequencing file and .sff is 454 sequencing. So, obviously if i will try to explain him that they both are the same file of 454 sequencing and I need additional files too...so, I need to show him research paper...

see Lex Nederbragt's blog, starting with this page about sff files:

http://contig.wordpress.com/2010/10/28/newbler-input-i-the-sff-file/#more-207

[paa6]

@SKLADGE

This is the first few lines of .sff file... I opened this file using less command in linux.. .sff^@^@^@^A^@^@^@^@.<E9><E8><A0>^@I<9E><A4>^@^C<AE>;^CH^@^D^C ^ATACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT

This is the first few lines of .qual file...I opened this file using less command in linux... >F0ZETIM04H8105 length=79 xy=3266_2039 region=4 run=R_2009_08_18_04_59_32_
36 35 35 37 37 37 37 37 37 35 35 40 39 39 39 40 40 40 40 40 39 39 39 40 40 39 39 39 37 37 37 38 38 37 31 23 23 21 20 19 27 30 30

[paa6]

see Lex Nederbragt's blog, starting with this page about sff files:

http://contig.wordpress.com/2010/10/...file/#more-207

thanks I will go through this...blog..

[sklages]

@SKLADGE

This is the first few lines of .sff file... I opened this file using less command in linux.. .sff^@^@^@^A^@^@^@^@.<E9><E8><A0>^@I<9E><A4>^@^C<AE>;^CH^@^D^C ^ATAC<shortened>ACGTACGTACGTACGTACGTACGTACGT

This is the first few lines of .qual file...I opened this file using less command in linux... >F0ZETIM04H8105 length=79 xy=3266_2039 region=4 run=R_2009_08_18_04_59_32_
36 35 35 37 37 37 37 37 37 35 35 40 39 39 39 40 40 40 40 40 39 39 39 40 40 39 39 39 37 37 37 38 38 37 31 23 23 21 20 19 27 30 30

Concerning your qual file: This is a 454 generated file, F0ZETIM04H8105 is the read id, xy are the coordinates, data is from region 4, the run took place at "2009_08_18".

Please, for the .sff file use the provided 'strings' commands. That's your "proof" then for your PI.

[paa6]

Concerning your qual file: This is a 454 generated file, F0ZETIM04H8105 is the read id, xy are the coordinates, data is from region 4, the run took place at "2009_08_18".

Please, for the .sff file use the provided 'strings' commands. That's your "proof" then for your PI.

ohh ok ...let me try these commands...do I need any specific environment for that??

[sklages]

ohh ok ...let me try these commands...do I need any specific environment for that??

No. Just a shell. Then type the command on the command line.

[GenoMax]

Guess we are convinced that this appears to be a 454 dataset (not illumina nor SOLiD).

@paa6: Ask the PI about missing corresponding "fna" files (which will have the actual sequence). If you can't get those files (and if the SFF files are corrupt) there is not much you are going to be able to do with just quality values.

[paa6]

No. Just a shell. Then type the command on the command line.

I tried these commands..no error message but file didn't open...what to do...

[paa6]

Guess we are convinced that this appears to be a 454 dataset (not illumina nor SOLiD).

@paa6: Ask the PI about missing corresponding "fna" files (which will have the actual sequence). If you can't get those files (and if the SFF files are corrupt) there is not much you are going to be able to do with just quality values.

yeah I think so you are right...ok I will talk to him and let u know what he replied...

[sklages]

He wanted a "proof"; checking for run_type or instrument_model gives him this "proof". :-)

It should be clear though that his dataset is incomplete; missing sequence file(s), possibly truncated SFF file. Maybe there were some problems during transfer to the USB device? Who knows ..

He could even check this: the final rows of 'strings' run on an SFF file should give the manifest followed by the read IDs ..

[sklages]

I tried these commands..no error message but file didn't open...what to do...

Again, please give us a bit more details,

What did you type and what did you get?

[paa6]

He wanted a "proof"; checking for run_type or instrument_model gives him this "proof". :-)

It should be clear though that his dataset is incomplete; missing sequence file(s), possibly truncated SFF file. Maybe there were some problems during transfer to the USB device? Who knows ..

He could even check this: the final rows of 'strings' run on an SFF file should give the manifest followed by the read IDs ..

YEAH RIGHT...thanks a lot...at least I can say this to him...and am sorrry now it's 12.16 a.m. here.....i am tired so i will reply u in the morning.

[paa6]

Again, please give us a bit more details,

What did you type and what did you get?

I have typed
strings filename.sff | grep run_type
and then there is no change in the screen, so I typeed next command

strings filename.sff | grep instrument_model

but still no change in he screen, I mean file didn't open...