I am preparing a custom library for paired end sequencing.
It is a low complexity lib. To circumvent the problem with cluster calling I have included NNNNN from the end that will be sequenced first (right after the ACACTCTTTCCCTACACGACGCTCTTCCGATCT which I assume is used for the first read)
I wonder whether I need to put NNNNN on the other side as well? Does the reverse read use the cluster positional information generated during the first read?
any thoughts - deeply appreciated
It is a low complexity lib. To circumvent the problem with cluster calling I have included NNNNN from the end that will be sequenced first (right after the ACACTCTTTCCCTACACGACGCTCTTCCGATCT which I assume is used for the first read)
I wonder whether I need to put NNNNN on the other side as well? Does the reverse read use the cluster positional information generated during the first read?
any thoughts - deeply appreciated
Comment