Hi,
i am uncertain what is the actual sequence of the read2 primer on Hiseq, PE amplicon sequencing.
To my understanding it should be HP11.
Is ATCTCGTATGCCGTCTTCTGCTTG the correct sequence for HP11 ?
i am uncertain what is the actual sequence of the read2 primer on Hiseq, PE amplicon sequencing.
To my understanding it should be HP11.
Is ATCTCGTATGCCGTCTTCTGCTTG the correct sequence for HP11 ?
Comment