Output from the next generation sequencing

[zammy]

Hello everyone
I hope I am posting my question in the right place, if not then kindly move it to the right section, Thanks!!!

I have question about the results we get from NGS. If I send my samples to any commercial NGS service provider and once the library preparation etc steps are performed then in which format should I expect the sequencing results for further analysis? What kind or type of files should I expect to receive? Any specific type/format of files?

Regards
Zammy

[dpryan]

Fastq is the standard format. It will probably be compressed to save space. If you asked for any sort of analysis, then you might get a SAM or BAM file and possibly a spreadsheet for Excel in addition.

[zammy]

Fastq is the standard format. It will probably be compressed to save space. If you asked for any sort of analysis, then you might get a SAM or BAM file and possibly a spreadsheet for Excel in addition.

Dear Ryan
Thank you for your reply!!
I had sent my samples to BGI. They have given me ID and password to download files from the ftp site. There I see two zip folders namely, upload.tar (1MB) and clean.tar (32MB). I have downloaded both from there. The clean folder further contains different folders each named according to my samples labeling. Moving into the sample folders, each folder contains following five files:
1. clean.txt
2. sample.fa file (the biggest file in each folder)
3. Length distribution.txt
4. Sample1 MD5SUM file
5. small.txt

Please tell me if this is how should I be getting the data files? Anything missing here or anything that I should be asking for to them before they delete the data?

[dpryan]

Ah, are you having them de novo assemble a small organism? That would explain the sample.fa file (though it'd be nice if they provided the original reads in addition to the assembly).

[DonDolowy]

I guess it depends on what you send for sequencing? But to me, it sounds like something is missing. At least the file sizes of the files are very small.

I assume that some kind of customer service comes with using a commercial NGS service, so why don´t you just write/call them and ask?

[zammy]

Ah, are you having them de novo assemble a small organism? That would explain the sample.fa file (though it'd be nice if they provided the original reads in addition to the assembly).

No, I have not mentioned any such thing to do as far as I know. My samples are total RNA extracted from human tissues that were sent for miRNA profiling and I don't think de novo assembly is needed here.

I guess it depends on what you send for sequencing? But to me, it sounds like something is missing. At least the file sizes of the files are very small. I assume that some kind of customer service comes with using a commercial NGS service, so why don´t you just write/call them and ask?

Well, I have sent them email and waiting for reply from two days...Since its my first time with NGS data, so I want to be sure of what I am asking to them that's why I requested here to kindly explain me . Kindly tell me what is missing here and what other files should I ask for to them? I have been going through NGS miRNA papers, where authors describe about analysis of "sequence reads", filtering/trimming and then alignment of reads to reference genome and miRbase etc. Now here in my data, I am not sure which files refer to reads even if they are already filtered and are they in proper format to be used in further analysis steps?

[dpryan]

Looks like there are files missing then. If they didn't send along instructions that describe the files that they consider "deliverables" then they screwed something up. You're paying them, you shouldn't have to read their minds!

[zammy]

Looks like there are files missing then. If they didn't send along instructions that describe the files that they consider "deliverables" then they screwed something up. You're paying them, you shouldn't have to read their minds!

Attached is the sequencing report that I received for my samples, Please check does it looks okay or what it means..

[dpryan]

I don't see anything off in there upon a cursory glance (I don't do miRNA-seq, so I'd be less likely to notice something specific to that being off). They mention fastq files as a deliverable in section 3.2, so you should expect to receive them (eventually).

[Tong.W]

I am come from BGI, if you have any questions, you can add my skype, [email protected], some question about NGS, i think i can help you.

[E.Azadian]

Greeting

I want to study some features of human miRNAs. I need more lengths at 5' & 3' ends for each miRNA concerning the data provided by the miRBase(www.mirbase.org). For example for hsa-mir-6723 the miRBase has provided followed sequence:
5'AUGCAUCGGGAUAGUCCGAGUAACGUCGGGGCAUUCCGGAUAGGCCGAGAAAGUGUUGUGGGAAGAAAGUUAGAUUUACGCCGAUGAAU-3'
As you may know this is called "pre-miRNA" which after some splicing, it produces functional miRNA which is called mature miRNA(11-32).
I want 100 nucleotides more in upstream and downstream of this pre-miRNA. By use of this miRNA's coordination ,chr1: 567705-567793 [-], and use of
the Table Browser (http://genome.ucsc.edu/cgi-bin/hgTables) I got its DNA sequences (by add 100 nucleotides more in upstream and downstream).
Finally I replaced its DNA nucleotide symbols by RNA symbols simply for further analysis.
I'm not sure about the accuracy of this method and I'm going to do this for hundreds of miRNAs. Would you please give me some kind advice.