Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Primer and adapter design for small RNA sequencing in HiSeq2000 and MiSeq

    Hi,
    I need to sequence pools of small RNA (each pool with varying size ranging from 20-100 bases, so planning to use barcode for each pool) using Hiseq2000 or MiSeq. I don't have in-house access for NGS instruments. I need to design the primers with barcodes that are compatible in Hiseq2000 or Miseq. I will be sending the final PCR products for sequencing. I looked into different websites including Illumina for the adapter and primer sequences to design the primer sequences but couldn't find one.
    Can anyone help me with information about the needed sequences? It will be single end, multiplexed, using single lane. I don't need deep coverage. 10000 reads/pool is sufficient.
    My design template of possible final PCR product is as follow. Please let me know if I am on right track ?
    3'GTTCGTCTTCTGCCGTATGCT-----NNNNNCTAGCAGCCTGACATCTTGAGACTTGG
    ACAGCCACCAGCGGCATAGTAA'5
    where ---- my RNA insert sequences ( only one strand is shown here).
    NNNNN - barcode.
    Thanks in advance.

  • #2
    Illumina Truseq adapter sequences

    If you speak to an Illumina sequencing customer service person and request a pdf with the adapter sequences, they will send it to you. In the past they have sent the pdf to anyone who requested it.

    Comment


    • #4
      It sounds like you're trying to make your own libraries (not using a kit) ? Most kits will include the adapters you need. We have a description of some Small RNA Seq kits in our library prep guide.

      How many samples do you plan on pooling? It sounds like you can afford to multiplex several samples. I would recommend a 36 or 50 cycle SE run. Using our shop by project, here are a few examples of 36 or 50 SE run services you could order.

      - Genohub

      Comment

      Latest Articles

      Collapse

      • seqadmin
        Current Approaches to Protein Sequencing
        by seqadmin


        Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...
        04-04-2024, 04:25 PM
      • seqadmin
        Strategies for Sequencing Challenging Samples
        by seqadmin


        Despite advancements in sequencing platforms and related sample preparation technologies, certain sample types continue to present significant challenges that can compromise sequencing results. Pedro Echave, Senior Manager of the Global Business Segment at Revvity, explained that the success of a sequencing experiment ultimately depends on the amount and integrity of the nucleic acid template (RNA or DNA) obtained from a sample. “The better the quality of the nucleic acid isolated...
        03-22-2024, 06:39 AM

      ad_right_rmr

      Collapse

      News

      Collapse

      Topics Statistics Last Post
      Started by seqadmin, 04-11-2024, 12:08 PM
      0 responses
      13 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 04-10-2024, 10:19 PM
      0 responses
      17 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 04-10-2024, 09:21 AM
      0 responses
      14 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 04-04-2024, 09:00 AM
      0 responses
      43 views
      0 likes
      Last Post seqadmin  
      Working...
      X