Primer and adapter design for small RNA sequencing in HiSeq2000 and MiSeq

[windhorse8]

Hi,
I need to sequence pools of small RNA (each pool with varying size ranging from 20-100 bases, so planning to use barcode for each pool) using Hiseq2000 or MiSeq. I don't have in-house access for NGS instruments. I need to design the primers with barcodes that are compatible in Hiseq2000 or Miseq. I will be sending the final PCR products for sequencing. I looked into different websites including Illumina for the adapter and primer sequences to design the primer sequences but couldn't find one.
Can anyone help me with information about the needed sequences? It will be single end, multiplexed, using single lane. I don't need deep coverage. 10000 reads/pool is sufficient.
My design template of possible final PCR product is as follow. Please let me know if I am on right track ?
3'GTTCGTCTTCTGCCGTATGCT-----NNNNNCTAGCAGCCTGACATCTTGAGACTTGG
ACAGCCACCAGCGGCATAGTAA'5
where ---- my RNA insert sequences ( only one strand is shown here).
NNNNN - barcode.
Thanks in advance.

[anusrinivasan]

Illumina Truseq adapter sequences

If you speak to an Illumina sequencing customer service person and request a pdf with the adapter sequences, they will send it to you. In the past they have sent the pdf to anyone who requested it.

[winsettz]

http://support.illumina.com/downloads/illumina_adapter_sequences_letter.ilmn

[Genohub]

It sounds like you're trying to make your own libraries (not using a kit) ? Most kits will include the adapters you need. We have a description of some Small RNA Seq kits in our library prep guide.

How many samples do you plan on pooling? It sounds like you can afford to multiplex several samples. I would recommend a 36 or 50 cycle SE run. Using our shop by project, here are a few examples of 36 or 50 SE run services you could order.

- Genohub