Tweet
Hello
My name is Gabriel. I'm writing here because I'm analyzing Illumina reads (generated in a Hiseq 2000) from a genome of a particular insect species. So far, I've managed to remove the adapter sequence (including the indexed adapter), but when checking my filtered FastQ files with the latest FastQC version (V 0.11.2) I am seeing a weird kmer pattern in the 5' region, it seems that a particular sequence is over represented, but the overrepresented sequence module does not show anything weird.
Also, the Kmer content overrepresented has a strong bias towards GC (i.e GGCCCGG, GCCCGGG and so on). I've also managed to overlap the Kmers to this sequence GGGCCATACTAGTACTGGATGCATCTGCAGGATATCGCGGCCGC but so far I've not been able to find anything related to this particular sequence. I'm concerned wheter it is OK to just trim this sequence, as I don't know how which meaning has this particular pattern.
So far and during my web search, I've only seen similar patterns when analyzing RNA-seq data, but this is not the case. Also, the "bad sequence" example from FastQC webpage shows a similar pattern, but in the 3' end, not in the 5' region, as this is my scenario.
It is worth noting that I have Paired end (2x100) files, and both files (1 and 2) have the same pattern.
I have attached the Kmer module graphs, I can add more information if needed.
Thank you very much, (and sorry for my english :P)
Gabriel
My name is Gabriel. I'm writing here because I'm analyzing Illumina reads (generated in a Hiseq 2000) from a genome of a particular insect species. So far, I've managed to remove the adapter sequence (including the indexed adapter), but when checking my filtered FastQ files with the latest FastQC version (V 0.11.2) I am seeing a weird kmer pattern in the 5' region, it seems that a particular sequence is over represented, but the overrepresented sequence module does not show anything weird.
Also, the Kmer content overrepresented has a strong bias towards GC (i.e GGCCCGG, GCCCGGG and so on). I've also managed to overlap the Kmers to this sequence GGGCCATACTAGTACTGGATGCATCTGCAGGATATCGCGGCCGC but so far I've not been able to find anything related to this particular sequence. I'm concerned wheter it is OK to just trim this sequence, as I don't know how which meaning has this particular pattern.
So far and during my web search, I've only seen similar patterns when analyzing RNA-seq data, but this is not the case. Also, the "bad sequence" example from FastQC webpage shows a similar pattern, but in the 3' end, not in the 5' region, as this is my scenario.
It is worth noting that I have Paired end (2x100) files, and both files (1 and 2) have the same pattern.
I have attached the Kmer module graphs, I can add more information if needed.
Thank you very much, (and sorry for my english :P)
Gabriel
Comment