Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • #16
    Originally posted by nucacidhunter View Post
    I wonder if you are using custom sequencing primers. Your read2 sequencing primer might not be optimal in addition to other reasons given previously. I think you need to provide more information about the library and sequencing metrics to enable others to help you effectively.
    i am new in this field. can anyone tell me how to check the cluster density. just in case this is casued by amplicon diversity issue, is there any trick to aviod this problem happens again. thank you guys so much!

    I will send more sequencing metrics.

    Comment


    • #17
      Read1

      [IMG][/IMG]

      Comment


      • #18

        Comment


        • #19
          read2

          Comment


          • #20
            Originally posted by nucacidhunter View Post
            I wonder if you are using custom sequencing primers. Your read2 sequencing primer might not be optimal in addition to other reasons given previously. I think you need to provide more information about the library and sequencing metrics to enable others to help you effectively.
            in this library,i use the custom sequencing primers
            P5 primer:AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
            P7 primer:CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC

            Comment


            • #21
              Originally posted by dalin View Post
              thanks for your reply, which explained a lot. Yes I am using amplicon. The worse is that my library has only about 20bp diverse sequence in 5 and 3 end. the sequence in between is a linker, means there is no diverse at all. i cannot change my library. but hope there will be a trick to circle this problem.

              After these FastQC reports and your explanation, the issue should not be generated by over-clustering.

              As nucacidhunter said, you may give more info for trouble shoot, like listed below:

              (1) What/which protocol/kit for library construction?
              (2) Adapter system you used? e.g. Nextera or TruSeq LT, if you used custom primers / adaptors, please give intact sequences of them, cannot recognize "the sequencing primers" you provided.
              (3) Sequencing run type you used? eg. V3 high output run of HiSeq PE100.
              (4) % of PhiX spike-in?

              Comment


              • #22
                I wait with bated breath. This is the most terrible run I have ever seen! It looks to me like it ran out of reagent after 100 cycles, but I'm betting on nucacidhunter for diagnosing it correctly.

                Comment


                • #23
                  Originally posted by Brian Bushnell View Post
                  I wait with bated breath. This is the most terrible run I have ever seen! It looks to me like it ran out of reagent after 100 cycles, but I'm betting on nucacidhunter for diagnosing it correctly.
                  Thanks for reply, In this library,i only PCR amplification for about 19 cycles......

                  Comment


                  • #24
                    Originally posted by weigrc View Post
                    After these FastQC reports and your explanation, the issue should not be generated by over-clustering.

                    As nucacidhunter said, you may give more info for trouble shoot, like listed below:

                    (1) What/which protocol/kit for library construction?
                    (2) Adapter system you used? e.g. Nextera or TruSeq LT, if you used custom primers / adaptors, please give intact sequences of them, cannot recognize "the sequencing primers" you provided.
                    (3) Sequencing run type you used? eg. V3 high output run of HiSeq PE100.
                    (4) % of PhiX spike-in?
                    in this library,i use the custom sequencing primers
                    P5 primer:AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
                    P7 primer:CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC

                    With the custom sequencing primers, the library sequence is
                    AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT--NNNNNNNNNNNNNNNNNNNN------GTCGGAGAATTCCTTACTAGTAGAACTCTGTTCTTGAGCTAGCATCGATGCTAGCTCAAGAACAGAGTTCTACTAGTAAGGAATTCTCCGAC----NNNNNNNNNNNNNNNNNNNN---GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG
                    thanks a lot!

                    Comment


                    • #25
                      From provided information I assume that your library insert size is around 130 bp with middle 90 bases being the same in all inserts and flanking 5' and 3' 20 bases divergent. The library structure contains truncated universal LT P5 and index1 P7 adapter with additional bases. Considering the position of P5 deletion and P7 addition this library should be suitable for sequencing with standard MiSeq reagents. Read1 sequence quality drops below 30 around 60th cycle which is below expected for 100 cycle sequencing. I would suggest that read2 low quality has been caused either by a fault in sequencer or MiSeq reagents. Reagents could have been faulty or used past expiry date or recommended handling has not been followed.

                      You have not mentioned the library prep method, but the data suggests that mid sequences of insert are not exactly the same.

                      Comment


                      • #26
                        Originally posted by nucacidhunter View Post
                        From provided information I assume that your library insert size is around 130 bp with middle 90 bases being the same in all inserts and flanking 5' and 3' 20 bases divergent. The library structure contains truncated universal LT P5 and index1 P7 adapter with additional bases. Considering the position of P5 deletion and P7 addition this library should be suitable for sequencing with standard MiSeq reagents. Read1 sequence quality drops below 30 around 60th cycle which is below expected for 100 cycle sequencing. I would suggest that read2 low quality has been caused either by a fault in sequencer or MiSeq reagents. Reagents could have been faulty or used past expiry date or recommended handling has not been followed.

                        You have not mentioned the library prep method, but the data suggests that mid sequences of insert are not exactly the same.
                        Thank you very much,the 5 and 3 flanking divergent sequence are accually 19-21 bp(probally mainly 20),we used hiseq 2000. other lines in this run looks fine. so it may not likely caused by reagent.
                        you suggest help me a lot, thank you!

                        Comment


                        • #27
                          I'm sorry i don't know the cluster density of the library. The Sequencing company have no information for the cluster density. teatv spice money login
                          Last edited by ashleylose07; 08-21-2021, 02:11 AM.

                          Comment

                          Latest Articles

                          Collapse

                          • seqadmin
                            Essential Discoveries and Tools in Epitranscriptomics
                            by seqadmin




                            The field of epigenetics has traditionally concentrated more on DNA and how changes like methylation and phosphorylation of histones impact gene expression and regulation. However, our increased understanding of RNA modifications and their importance in cellular processes has led to a rise in epitranscriptomics research. “Epitranscriptomics brings together the concepts of epigenetics and gene expression,” explained Adrien Leger, PhD, Principal Research Scientist...
                            04-22-2024, 07:01 AM
                          • seqadmin
                            Current Approaches to Protein Sequencing
                            by seqadmin


                            Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...
                            04-04-2024, 04:25 PM

                          ad_right_rmr

                          Collapse

                          News

                          Collapse

                          Topics Statistics Last Post
                          Started by seqadmin, 04-25-2024, 11:49 AM
                          0 responses
                          17 views
                          0 likes
                          Last Post seqadmin  
                          Started by seqadmin, 04-24-2024, 08:47 AM
                          0 responses
                          17 views
                          0 likes
                          Last Post seqadmin  
                          Started by seqadmin, 04-11-2024, 12:08 PM
                          0 responses
                          62 views
                          0 likes
                          Last Post seqadmin  
                          Started by seqadmin, 04-10-2024, 10:19 PM
                          0 responses
                          60 views
                          0 likes
                          Last Post seqadmin  
                          Working...
                          X