Non-Barcoded reads. Why?

[lncRNA]

Hello everybody!

I am pretty new in the NGS jungle and I am struggling with the making sense of some NGS data. I hope someone can help me out:

I have built a library with internal Barcodes which looks like the following:
SolexaP5-NNNN-Barcode-NNNN-DNAinsert-SolexaP3
N=random nucleotides to collapse PCR duplicates
SolexaP5:AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
SolexaP3:CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATC

Unfortunately, after Barcode splitting, I noticed that I have many reads with no Barcode.

Does any of you have an explanation why I get such non-barcoded reads?

Any input would be much appreciated

Thanks in advance!