how custom primers should be designed?

[transposn]

I am wondering whether my experiment (which was originally designed to work on a HiSeq) will work on NextSeq and MiSeq.

I have been making small RNA library that we send out to sequence in a HiSeq but we want to try to sequence it in our lab (MiSeq and/or NextSeq). The protocol we are using is a modified version of the Illumina TruSeq Small RNA in which the 3’ and 5’ adapters have been modified as well as the final adapters.

These are the final adapters (index) that are added in a final enrichment step to the samples:

Forward: AATGATACGGCGACCACCGAGATCTACACGACAGGTTCAGAGTTCTACAGTCCGACGA*T*C

Reverse: CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T

Note: NNNNNN (index)

Illumina Tech Support for help they gave us an option to design Custom Sequencing Primer but i have no idea how to design them.

Do you guys have any ideas or recommendations how custom primers should be designed?

Thank you very much!

[kmcarr]

If your libraries functioned on a HiSeq then they will function on a MiSeq or NextSeq. Any valid Illumina library will work with any of their currently supported instruments.