Dear friends
I have my library which is prepared using custom made primers published in a an article. My eventual product (double stranded of course) will look like this:
5'CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT(Insert)GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT3'
Though I had a run but the data quality from Illumina sequencer (Illumina Genome Analyzer II (GAIIx) was not good. The number of cluster formation was less compared to other samples on the same chip (run along with 7 other samples). I would like to know whether my final library product (sequence above) will hybridize properly with the oligos on the chip? Please suggest.
Biochembug
I have my library which is prepared using custom made primers published in a an article. My eventual product (double stranded of course) will look like this:
5'CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT(Insert)GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT3'
Though I had a run but the data quality from Illumina sequencer (Illumina Genome Analyzer II (GAIIx) was not good. The number of cluster formation was less compared to other samples on the same chip (run along with 7 other samples). I would like to know whether my final library product (sequence above) will hybridize properly with the oligos on the chip? Please suggest.
Biochembug