Does anyone have explicit, detailed information about the new TruSeq adaptor sequences and structures?
Seqanswers Leaderboard Ad
Collapse
Announcement
Collapse
No announcement yet.
X
-
I have same question.
Originally posted by seqgirl123 View PostHi,
I am a little confused with the various schematics I found on the Solexa adapter structure.
I followed Illumina's pdf (attached) and made the forked structure myself (jpeg). I also listed the variations I saw on the right taken from various schematics people have posted on this website which I think they took from other journal articles.
Can someone tell me if the sequences taken from Illumina's pdf are the correct forked structures as I've drawn them, meaning is that the way they're really supposed to look? My version has more bases ligating to each other versus the ones taken from this website which have fewer, why is that and does it make a difference? Thanks.
Comment
-
Originally posted by SeqTruth View PostDoes anyone have explicit, detailed information about the new TruSeq adaptor sequences and structures?
See paper below for discussion of 'complete adapters'
Nature Methods 6, 291 - 295 (2009) Amplification-free Illumina sequencing-library preparation facilitates improved mapping and assembly of (G+C)-biased genomes
Comment
-
Originally posted by NextGenSeq View PostYou have to ask Illumina for them. I posted a pdf of them but Illumina made this site take them down.Originally posted by ECO View PostHi guys/ScottC,
NextGenSeq is correct, ILMN does not want the TruSeq adapter sequences published here.
Apologies...
You're certainly allowed to publish 'individual sequences'...
"For individual sequences contained in this letter, lllumina grants you permission to distribute them outside your institution, or publish individual sequences in presentations, manuscripts, or publications authored by you, as long as it is accompanied by the following copyright notice:
Oligonucleotide sequences © 2007‐2011 Illumina, Inc. All rights reserved."
Comment
-
Yup. In this thread when they were posted initially, I received a very nice email from their Senior Patent Counsel. Post#4 in that thread has the statement ILMN asked me to include with the takedown.
I hadn't seen that release above...the original posting did have that copyright attached as I remember.
Comment
-
Ok, so somebody can maybe post those pdfs on a website somewhere, with some obvious search terms associated, and anyone with access to Google can find and download them; a minor inconvenience for now.
For those of us who already have the pdf with all the TruSeq sequences, it would be nice if someone could clarify the question of library amplification PCR primers for the TruSeq DNA and RNA sample prep kits...?
Comment
-
Does anyone have a schematic illustration (similar to what kmcarr has posted in this thread for SE and PE library construction and sequencing) when using Illumina's multiplex kits for library construction and sequencing. So far, I have seen the single end and paired end library construction and sequencing illustrations and they have been great learning tools for a lot of us here. Can someone post the same schematic for the multiplex library construction and sequencing?
In Illumina's version of multiplexing, they have a multiplex adapter, multiplex PCR primers, and a separate PCR index primer (3 PCR primers in all). The newer TruSeq kits brought this down to only 2 PCR primers in all, so there is only a multiplex adapter and the multiplex PCR primers (the index sequence is contained in the multiplex PCR primer I think is how it works). So I'm really looking for a schematic on Illumina's original multiplex kit and would much appreciate if someone can post their multiplex illustration here.
Comment
-
40% adaptor sequence
Thanks kmcarr, seggirl123 and protist for you kind sharing! These information are really helpful!
I just constructed 8 CHIP-SEQ libraries with 3 different input and 5 different CHIP libraries. After sequencing, the mapping result showed around 40% are adaptor sequence "GATCGGAAGAGCTCGTATGCCGTCTTCTGCTT" . Could anyone suggest which step could be wrong for the library preparation?
Thanks!
Comment
-
Originally posted by lizhen View PostThanks kmcarr, seggirl123 and protist for you kind sharing! These information are really helpful!
I just constructed 8 CHIP-SEQ libraries with 3 different input and 5 different CHIP libraries. After sequencing, the mapping result showed around 40% are adaptor sequence "GATCGGAAGAGCTCGTATGCCGTCTTCTGCTT" . Could anyone suggest which step could be wrong for the library preparation?
Thanks!
But, if you have access to a Pippin Prep instrument that will be even better. It will electro-elute your desired size range. It's a much cleaner method.
I've actually abandoned the Pippin and size-select after PCR. I do all of my DNA clean up steps with Ampure XP beads and PCR amplify the library first, then size-select. I never get adapter contamination anymore (I didn't with the Pippin either but my new method is way faster, has greater yield, and is cheaper).
Also, you should always run your library on a Bioanalyzer 2100 before you sequence. You can always size-select your library again to remove the problematic adapter concatamer. Otherwise, without this important quality control step you just might be wasting sequencing depth and wasting money.
Comment
Latest Articles
Collapse
-
by seqadmin
Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.
Somatic Genomics
“We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...-
Channel: Articles
05-24-2024, 01:16 PM -
-
by seqadmin
The sequencing world is rapidly changing due to declining costs, enhanced accuracies, and the advent of newer, cutting-edge instruments. Equally important to these developments are improvements in sequencing analysis, a process that converts vast amounts of raw data into a comprehensible and meaningful form. This complex task requires expertise and the right analysis tools. In this article, we highlight the progress and innovation in sequencing analysis by reviewing several of the...-
Channel: Articles
05-06-2024, 07:48 AM -
ad_right_rmr
Collapse
News
Collapse
Topics | Statistics | Last Post | ||
---|---|---|---|---|
Started by seqadmin, 05-24-2024, 07:15 AM
|
0 responses
195 views
0 likes
|
Last Post
by seqadmin
05-24-2024, 07:15 AM
|
||
Started by seqadmin, 05-23-2024, 10:28 AM
|
0 responses
218 views
0 likes
|
Last Post
by seqadmin
05-23-2024, 10:28 AM
|
||
Started by seqadmin, 05-23-2024, 07:35 AM
|
0 responses
221 views
0 likes
|
Last Post
by seqadmin
05-23-2024, 07:35 AM
|
||
Started by seqadmin, 05-22-2024, 02:06 PM
|
0 responses
12 views
0 likes
|
Last Post
by seqadmin
05-22-2024, 02:06 PM
|
Comment