building scaffolds using a contig and mate pair

[boetsie]

Hi all,

We are currently performing a de novo assembly using Illumina mate-pairs. we have assembled them using CLCBio, though with CLCBio no scaffolds can be produced, only contigs. Now we have mate pairs, so we would like to use them to make a scaffold.

The problem is that assembly programs like SOAPdenovo or SSAke etc. use files which where produced during contig assembling. They don't have a stand-alone program for just scaffolding a contig file.

Is there any software/algorithm available which has the contigs file (in .fasta format) and mate pair files as input, and can produce a scaffold? Or has someone a solution?

Kind regards,
Marten

[Zigster]

I'm pretty sure MIRA can do that. Set aside a couple days to read the manual though (it is very long)

[[email protected]]

Hi all,

We are currently performing a de novo assembly using Illumina mate-pairs. we have assembled them using CLCBio, though with CLCBio no scaffolds can be produced, only contigs. Now we have mate pairs, so we would like to use them to make a scaffold.

The problem is that assembly programs like SOAPdenovo or SSAke etc. use files which where produced during contig assembling. They don't have a stand-alone program for just scaffolding a contig file.

Is there any software/algorithm available which has the contigs file (in .fasta format) and mate pair files as input, and can produce a scaffold? Or has someone a solution?

Kind regards,
Marten

Marten, you can use Bambus 2.33 by AMOS. It takes contig and mate file as input. I am also trying to use it but i dont have mate file as required by Bambus. DO you know how to create mate file? I have paired end reads from illumina

[boetsie]

Thanks for the reply's, but I don't think you answers work..

MIRA uses Bambus for scaffolding (if i'm correct?).
Though, Bambus doesn't read in a .fasta file for scaffolding, it needs a .contig file, which i don't have. In addition, i can't put in the two mate-pair files i have (one for each read end), only a regular expression of how the two pairs are mated.

So, my input is;

- 1 .fasta file containing contigs
- 2 .fasta files containing the mate pairs

Is there a way to do this?

Kind regards,
Marten

[gabriel.lichtenstein]

any updates on this....

[boetsie]

any updates on this....

well, not yet. We also had the problem that we couldn't generate an .ace file for Bambus. We are currently working on a script for this problem, since none of the existing programs today can do this.

[mack]

I believe CLCBio export assemblies as ace file.

[boetsie]

I believe CLCBio export assemblies as ace file.

For large datasets, somehow no .ace files are produced.

[mack]

For large datasets, somehow no .ace files are produced.

How big is your dataset? I were able to export my dataset as ace with 17k contigs + 250k singletons.

[boetsie]

How big is your dataset? I were able to export my dataset as ace with 17k contigs + 250k singletons.

more than 1 million contigs

[danix]

building sacaffold using bambus - .mates problem

Hi, I'm trying to run bambus but I don't have any .mates. Does anyone know how can I create this files?
I have a 454 output (fasta + sff) from a bacteria genome and I assembled it with phrap, I already convert the .ace to .contig, using ace2contig from AMOS.
Thanx!

[boetsie]

Hi, I'm trying to run bambus but I don't have any .mates. Does anyone know how can I create this files?
I have a 454 output (fasta + sff) from a bacteria genome and I assembled it with phrap, I already convert the .ace to .contig, using ace2contig from AMOS.
Thanx!

This script i got from Sergey Koren from AMOS, (which i adapted a bit):

cat my.fasta |grep ">" |sed s/\>//g |sed 's/\/1*$/./g;s/\/2*$/./g'|awk -F "." '{print $1}' |sort |uniq -c |awk '{if ($1 == 2) print $2"/1\t"$2"/2\tsmall"}' > mates.txt

You need to put in the fasta file with the read names as 'my.fasta'.

The file 'my.fasta' requires filenames to end with /1 and /2.
If you have other file names, like .x and .y. You should replace;

sed 's/\/1*$/./g;s/\/2*$/./g'

to for example;

sed 's/.x*$/./g;s/.y*$/./g'

in the code above.

If you have two fasta files. Just insert one and change;
if ($1 == 2) to if ($1 == 1)
in the code, this way you only have to run it for one file.

This will print the names to 'mates.txt'. Only thing to do is to set your library name and insert sizes on the top of this file.

Bambus will probably generate a lot of errors, because some names are not found in the .contig file. But this shouldn't be a problem.

Hope this works otherwise ask me.

[danix]

building sacaffold using bambus - .mates problem

Thanx boetsie for your quick answer.
But I can't use your script in this project because the 454 outputs I have 454Reads.01.MID4.fna and 454Reads.02.MID4.fna, have sequences with different names, so all id is unique and it creates a mates.txt empty.
Besides, the other bacteria I'm working with has only one fasta from 454.

Both fasta are like this:
>F35ERS102DJ7GS rank=0000002 x=1343.0 y=826.0 length=56
ATCAGACACGGAGGCGTACGCGCCGCTGTTCCAGGTGATGCTGGCATTCCAGAACA
>F35ERS102DBYUE rank=0000006 x=1249.0 y=1428.0 length=69
ATCAGACACGCCGCCGGCACCTTCGCCGCTGCCGCGCTCGCCACCGGTGGCACCCGTCGT
GCTGTGGTC
>F35ERS102C47FN rank=0000036 x=1172.0 y=1361.0 length=68
ATCAGACACGAGGTGAAGACCGGTTTCCGTCGCGGCGGAGAATAGCCGAACATCAGCGCG
CGATCGGG

I'm wondering if there is a way to create the .mates from the data I have. Any other idea?

Thanx

[danix]

Thanx boetsie for your quick answer.
But I can't use your script in this project because the 454 outputs I have 454Reads.01.MID4.fna and 454Reads.02.MID4.fna, have sequences with different names, so all id is unique and it creates a mates.txt empty.
Besides, the other bacteria I'm working with has only one fasta from 454.

Both fasta are like this:
>F35ERS102DJ7GS rank=0000002 x=1343.0 y=826.0 length=56
ATCAGACACGGAGGCGTACGCGCCGCTGTTCCAGGTGATGCTGGCATTCCAGAACA
>F35ERS102DBYUE rank=0000006 x=1249.0 y=1428.0 length=69
ATCAGACACGCCGCCGGCACCTTCGCCGCTGCCGCGCTCGCCACCGGTGGCACCCGTCGT
GCTGTGGTC
>F35ERS102C47FN rank=0000036 x=1172.0 y=1361.0 length=68
ATCAGACACGAGGTGAAGACCGGTTTCCGTCGCGGCGGAGAATAGCCGAACATCAGCGCG
CGATCGGG

I'm wondering if there is a way to create the .mates from the data I have. Any other idea?

Thanx

Complementing the information I gave before:
454Reads.01.MID4.fna is like this:
>FZ92HC101CZUHH length=41 xy=1111_1155 region=1 run=R_2009_08_04_12_33_02_
CGCGCGTTTCTCGTACGGCTCGCTGTATCCGACNCGCGCGC
>FZ92HC101DJEHD length=46 xy=1334_0127 region=1 run=R_2009_08_04_12_33_02_
GTCTCGCGTCGTGTCTTCGCGTCGTATGCGGTACTGGTCAGGCGTT

454Reads.02.MID4.fna is like this:
>FZ92HC102IDBLW length=40 xy=3315_0370 region=2 run=R_2009_08_04_12_33_02_
CGCGCGTTCTCGTACGGCTCGCTGTATCCGACNCGCGCGC
>FZ92HC102JYG94 length=40 xy=3966_0618 region=2 run=R_2009_08_04_12_33_02_
CGCGCGTTCTCGTACGGCTCGCTGTATCCGACNCGCGCGC

Can I extract any information from these fastas to create a .mates?
Thanx

[boetsie]

Complementing the information I gave before:
454Reads.01.MID4.fna is like this:
>FZ92HC101CZUHH length=41 xy=1111_1155 region=1 run=R_2009_08_04_12_33_02_
CGCGCGTTTCTCGTACGGCTCGCTGTATCCGACNCGCGCGC
>FZ92HC101DJEHD length=46 xy=1334_0127 region=1 run=R_2009_08_04_12_33_02_
GTCTCGCGTCGTGTCTTCGCGTCGTATGCGGTACTGGTCAGGCGTT

454Reads.02.MID4.fna is like this:
>FZ92HC102IDBLW length=40 xy=3315_0370 region=2 run=R_2009_08_04_12_33_02_
CGCGCGTTCTCGTACGGCTCGCTGTATCCGACNCGCGCGC
>FZ92HC102JYG94 length=40 xy=3966_0618 region=2 run=R_2009_08_04_12_33_02_
CGCGCGTTCTCGTACGGCTCGCTGTATCCGACNCGCGCGC

Can I extract any information from these fastas to create a .mates?
Thanx

Hmmm i see it, it's 454, that doesn't have a prefix like .x or /1. (sorry, i have never worked with 454 data before )

Can you tell me how your .contig file looks like?

The mate file should have the same name as the first string after the "#" line in the .contig file. This line represents which read has mapped to the contig (starting with ##).

So if the line with "#" starts with e.g. FZ92HC102IDBLW, followed by the offset in parantheses, like;

#FZ92HC102IDBLW(0)

you should extract the names out of both files and put them in the same file

If this is indeed the case, you can use my script i attached.
Use it with;

perl testmates.pl file1 file2

It will generate a txt file with the mates. Only thing to do is put the library sizes at the top of the file.

more info about .contig file at http://www.cbcb.umd.edu/research/con...entation.shtml

Hope this helps.