Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • metheuse
    Member
    • Jan 2013
    • 84

    Unknown sequences in R2 that couldn't be mapped

    I've run Bismark to align a set of BS-Seq data. Some (not all) of the samples had low mapping efficiency (~20%). I then tried mapping R1 and R2 separately and found that R1 mapped at >70% while R2 mapped at ~30% (both in undirectional mode). Then I tried bsseeker and it reported a 72.2% mapping rate. By checking the CIGAR, I saw that most of the R2 reads contained a not short soft clipping in the ends (e.g. 91M60S). An examples of these reads is:

    A00437:548:HN5NMDSX3:1:1101:24939:1344 (aligned by bsseeker but not bismark. CIGAR: 60M91S; POS: chr1:159204290)
    AAGTTTTTTATATATAGATATGTGTATAATGATATATAGTAAATGTATATAGAGTTTAGTGTGAGAGTGGGAGGGTTGGGGTGGTTGTTGAGGTTGTATAATGAAGTTATTTTAGGGAGTTATTGGGTGTTTGTTTAGTTATTTATGGGTT

    The bolded part was soft-clipped, while the front part mapped to chr1:159204290-159204349 (60nt) if converting all Cs to Ts in the reference.
    I checked the fastqc of these reads but didn't see adaptor contamination or over-represented sequences in R2, so it's a mystery what these clipped sequences are and why they occur only in R2. Does anyone have any ideas? Thanks.

Latest Articles

Collapse

  • SEQadmin2
    Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
    by SEQadmin2



    Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
    ...
    07-09-2026, 11:10 AM
  • SEQadmin2
    Cancer Drug Resistance: The Lingering Barrier to Rising Survival
    by SEQadmin2



    Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

    There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
    07-08-2026, 05:17 AM
  • GATTACAT
    Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
    by GATTACAT
    Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
    07-01-2026, 11:43 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by SEQadmin2, 07-13-2026, 10:26 AM
0 responses
24 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 07-09-2026, 10:04 AM
0 responses
34 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 07-08-2026, 10:08 AM
0 responses
21 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 07-07-2026, 11:05 AM
0 responses
34 views
0 reactions
Last Post SEQadmin2  
Working...