Seqanswers Leaderboard Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • metheuse
    Member
    • Jan 2013
    • 84

    Unknown sequences in R2 that couldn't be mapped

    I've run Bismark to align a set of BS-Seq data. Some (not all) of the samples had low mapping efficiency (~20%). I then tried mapping R1 and R2 separately and found that R1 mapped at >70% while R2 mapped at ~30% (both in undirectional mode). Then I tried bsseeker and it reported a 72.2% mapping rate. By checking the CIGAR, I saw that most of the R2 reads contained a not short soft clipping in the ends (e.g. 91M60S). An examples of these reads is:

    A00437:548:HN5NMDSX3:1:1101:24939:1344 (aligned by bsseeker but not bismark. CIGAR: 60M91S; POS: chr1:159204290)
    AAGTTTTTTATATATAGATATGTGTATAATGATATATAGTAAATGTATATAGAGTTTAGTGTGAGAGTGGGAGGGTTGGGGTGGTTGTTGAGGTTGTATAATGAAGTTATTTTAGGGAGTTATTGGGTGTTTGTTTAGTTATTTATGGGTT

    The bolded part was soft-clipped, while the front part mapped to chr1:159204290-159204349 (60nt) if converting all Cs to Ts in the reference.
    I checked the fastqc of these reads but didn't see adaptor contamination or over-represented sequences in R2, so it's a mystery what these clipped sequences are and why they occur only in R2. Does anyone have any ideas? Thanks.

Latest Articles

Collapse

  • seqadmin
    Pathogen Surveillance with Advanced Genomic Tools
    by seqadmin




    The COVID-19 pandemic highlighted the need for proactive pathogen surveillance systems. As ongoing threats like avian influenza and newly emerging infections continue to pose risks, researchers are working to improve how quickly and accurately pathogens can be identified and tracked. In a recent SEQanswers webinar, two experts discussed how next-generation sequencing (NGS) and machine learning are shaping efforts to monitor viral variation and trace the origins of infectious...
    03-24-2025, 11:48 AM
  • seqadmin
    New Genomics Tools and Methods Shared at AGBT 2025
    by seqadmin


    This year’s Advances in Genome Biology and Technology (AGBT) General Meeting commemorated the 25th anniversary of the event at its original venue on Marco Island, Florida. While this year’s event didn’t include high-profile musical performances, the industry announcements and cutting-edge research still drew the attention of leading scientists.

    The Headliner
    The biggest announcement was Roche stepping back into the sequencing platform market. In the years since...
    03-03-2025, 01:39 PM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, 03-20-2025, 05:03 AM
0 responses
41 views
0 reactions
Last Post seqadmin  
Started by seqadmin, 03-19-2025, 07:27 AM
0 responses
49 views
0 reactions
Last Post seqadmin  
Started by seqadmin, 03-18-2025, 12:50 PM
0 responses
36 views
0 reactions
Last Post seqadmin  
Started by seqadmin, 03-03-2025, 01:15 PM
0 responses
191 views
0 reactions
Last Post seqadmin  
Working...