Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Unknown sequences in R2 that couldn't be mapped

    I've run Bismark to align a set of BS-Seq data. Some (not all) of the samples had low mapping efficiency (~20%). I then tried mapping R1 and R2 separately and found that R1 mapped at >70% while R2 mapped at ~30% (both in undirectional mode). Then I tried bsseeker and it reported a 72.2% mapping rate. By checking the CIGAR, I saw that most of the R2 reads contained a not short soft clipping in the ends (e.g. 91M60S). An examples of these reads is:

    A00437:548:HN5NMDSX3:1:1101:24939:1344 (aligned by bsseeker but not bismark. CIGAR: 60M91S; POS: chr1:159204290)
    AAGTTTTTTATATATAGATATGTGTATAATGATATATAGTAAATGTATATAGAGTTTAGTGTGAGAGTGGGAGGGTTGGGGTGGTTGTTGAGGTTGTATAATGAAGTTATTTTAGGGAGTTATTGGGTGTTTGTTTAGTTATTTATGGGTT

    The bolded part was soft-clipped, while the front part mapped to chr1:159204290-159204349 (60nt) if converting all Cs to Ts in the reference.
    I checked the fastqc of these reads but didn't see adaptor contamination or over-represented sequences in R2, so it's a mystery what these clipped sequences are and why they occur only in R2. Does anyone have any ideas? Thanks.

Latest Articles

Collapse

  • seqadmin
    Current Approaches to Protein Sequencing
    by seqadmin


    Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...
    04-04-2024, 04:25 PM
  • seqadmin
    Strategies for Sequencing Challenging Samples
    by seqadmin


    Despite advancements in sequencing platforms and related sample preparation technologies, certain sample types continue to present significant challenges that can compromise sequencing results. Pedro Echave, Senior Manager of the Global Business Segment at Revvity, explained that the success of a sequencing experiment ultimately depends on the amount and integrity of the nucleic acid template (RNA or DNA) obtained from a sample. “The better the quality of the nucleic acid isolated...
    03-22-2024, 06:39 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, 04-11-2024, 12:08 PM
0 responses
18 views
0 likes
Last Post seqadmin  
Started by seqadmin, 04-10-2024, 10:19 PM
0 responses
22 views
0 likes
Last Post seqadmin  
Started by seqadmin, 04-10-2024, 09:21 AM
0 responses
16 views
0 likes
Last Post seqadmin  
Started by seqadmin, 04-04-2024, 09:00 AM
0 responses
47 views
0 likes
Last Post seqadmin  
Working...
X