Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • metheuse
    Member
    • Jan 2013
    • 84

    Unknown sequences in R2 that couldn't be mapped

    I've run Bismark to align a set of BS-Seq data. Some (not all) of the samples had low mapping efficiency (~20%). I then tried mapping R1 and R2 separately and found that R1 mapped at >70% while R2 mapped at ~30% (both in undirectional mode). Then I tried bsseeker and it reported a 72.2% mapping rate. By checking the CIGAR, I saw that most of the R2 reads contained a not short soft clipping in the ends (e.g. 91M60S). An examples of these reads is:

    A00437:548:HN5NMDSX3:1:1101:24939:1344 (aligned by bsseeker but not bismark. CIGAR: 60M91S; POS: chr1:159204290)
    AAGTTTTTTATATATAGATATGTGTATAATGATATATAGTAAATGTATATAGAGTTTAGTGTGAGAGTGGGAGGGTTGGGGTGGTTGTTGAGGTTGTATAATGAAGTTATTTTAGGGAGTTATTGGGTGTTTGTTTAGTTATTTATGGGTT

    The bolded part was soft-clipped, while the front part mapped to chr1:159204290-159204349 (60nt) if converting all Cs to Ts in the reference.
    I checked the fastqc of these reads but didn't see adaptor contamination or over-represented sequences in R2, so it's a mystery what these clipped sequences are and why they occur only in R2. Does anyone have any ideas? Thanks.

Latest Articles

Collapse

  • SEQadmin2
    From Collection to Sequencing: Why Sample Preparation and Preservation Define Sequencing Data
    by SEQadmin2


    Data variability is still an issue in sequencing technologies despite the advances in reproducibility and accuracy of these platforms. But the problem does not originate in the sequencing itself, but in the previous steps, before the sample reaches the sequencer.


    The first step is collection, followed by preservation and sample preparation for analysis. Most scientists overlook those steps, but not being careful might just be skewing the experiment’s results.
    ...
    06-02-2026, 10:05 AM
  • SEQadmin2
    Single-Cell Sequencing at an Inflection Point: Early Impacts of New Platforms and Emerging Trends
    by SEQadmin2


    With the launch of new single-cell sequencing platforms in 2026, the field stands at an exciting inflection point. This article surveys the most impactful advances in the field and discusses how they’re reshaping research in cancer, immunology, and beyond.


    Introduction

    Single-cell sequencing technologies have undergone remarkable advances over the past decade, transitioning from low-throughput experimental approaches to highly scalable platforms capable of...
    05-22-2026, 06:42 AM
  • SEQadmin2
    Environmental Genomics in the Age of NGS: From Microbes to Conservation Strategies
    by SEQadmin2

    Studying ecosystems means dealing with complex, multi-species communities that are hard to observe at scale. This complexity, however, hides many important questions to be answered, from how biogeochemical cycles work and how climate change can affect species distribution to how conservation strategies can work best.


    Genomics, particularly since the expansion of NGS, has transformed ecosystem ecology. By sequencing environmental DNA, we can now assess biodiversity without direct...
    05-06-2026, 09:04 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by SEQadmin2, Yesterday, 08:59 AM
0 responses
14 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 06-02-2026, 12:03 PM
0 responses
22 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 06-02-2026, 11:40 AM
0 responses
19 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 05-28-2026, 11:40 AM
0 responses
32 views
0 reactions
Last Post SEQadmin2  
Working...