BISMARK paired-end result sam file contains on read1 info

[mbk0asis]

Hello, I ran bismark with paired-end reads.
According to the manual, the result SAM file should had contained both read 1 and 2 sequences, mapping qual, and etc. But I didn't get them both.
I used TrmGalore for adapter removal with the paired-end option to make sure both mates were paired.

Command I used :

bismark --non_directional --bowtie2 -p 8 -N 1 -L 10 ../mm10/ -1 MEF_R1_val_1.fq -2 MEF_R2_val_2.fq

Here's some examples from my result,

HISEQ:284:HAK1MADXX:1:1101:1451:2148_1:N:0:CGATGT       99      chr7    48002502        23      101M    =       48002628        227     AAATGTGGTATATTTATATAATGGAGTATTATTTAGTTATTAAAAAGAGTGTATTTATGAAATTTTTAGTTAAATGGATGGATTTGGAGGGTATTATTTTG   C@CFFFEFFHHHHJJIJIJIJIJJJJJHJJJJJJJIJIJIIIIIJHIEGBDEGHIJGJJJIGJJJJJJIJJIHIIJJHHGGGHIJJHAEFF5@@D>CEEEA   NM:i:19 MD:Z:10C2C2C1C9C2C1C2C11A15C0C3C0C11C0C7C2C2C0C2        XM:Z:..........h..h..h.h.........h..h.x..h...........................hh...hh...........hx.......h..h..hx..      XR:Z:CT XG:Z:CT
HISEQ:284:HAK1MADXX:1:1101:1451:2148_1:N:0:CGATGT       147     chr7    48002628        23      101M    =       48002502        -227    ATTTATATAATATGTATTTATTGATAAGTGTTTATTAGTTTAAAATTTAGGATATTTAAGATATAAGATATAATTTATTAAATATATGAAATTTAAGAAGA   FDCHHHHHHHIIGGIGDGFGGIHDIHJJJHIJJJJJIIIIJJHIIEJJJJJJIGGIJJIJJJJJIHFIJJJJIHHC,IJIGJJIJJJJHHHHDDFFFFCCC   NM:i:23 MD:Z:1C1C1C1C8C1C1C9C7C0C0C5C7C0C0C13C5G0C4C1C6C1C5A1   XM:Z:.h.h.h.h........h.h.x.........h.......hhh.....h.......hhh.............h......h....h.h......h.h.......      XR:Z:GA XG:Z:CT

Thank you.

[frozenlyse]

The first row is read 1, and the second row is read 2 - you can tell from the SAM flag (second column)

99 == 0x01 + 0x02 + 0x20 + 0x40 which translates to "template having multiple segments in sequencing" + "each segment properly aligned according to the aligner" + "SEQ of the next segment in the template being reversed" + "the first segment in the template"

147 == 0x01 + 0x02 + 0x10 ("SEQ being reverse complemented") + 0x80 ("the last segment in the template").

[mbk0asis]

Thank you for your answer!
I think 'frozenlyse' is right.
I tried SAM flag interpreter (?) and confirmed they were indeed properly paired reads.

'99' means;
read paired
read mapped in proper pair
mate reverse strand
first in pair

'147' means;
read paired
read mapped in proper pair
read reverse strand
second in pair

By the way, what does the 'read reverse strand' means?

[dpryan]

"Read reverse strand" means that the reverse complement of the read aligned, rather than the read itself. In other words, it mapped to the "-" strand rather than the "+" strand (leaving out that things aren't that simple in bisulfite sequencing...the fragment that gave rise to those example reads originated from the original + strand...if you want to know more about this then have a look at the trim_galore manual where Felix went over things quite nicely).