Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • mavishou
    Junior Member
    • Jun 2011
    • 1

    How to extract multi-mapped reads by samtools?

    Hi guys,
    I’m working with some RNA seq data and get some problems.

    I mapped the paired-end reads on tophat and got the result in sam/bam format. Now I’m using samtools to analyze the result.

    I want to extract the reads that map to more than one place in the genome, and this is my command line:
    Samtools view –h –f 0x100 in.bam > out.sam
    There are no output alignmens in the out.sam except the head, which means there are no multi-mapped reads

    However, I’ve run my own program in perl and find that there’re lots of reads whose IDs appear more than twice in the sam file, which means .these read mapped more than one place in the genome. (Two paired-end reads have the same ID, so most of the time, a certain ID appearing twice means it’s a unique mapping)

    I want to know whether my command line is right? I mean whether 0x100 is the right parameter to extract multi-mapped reads.
  • westerman
    Rick Westerman
    • Jun 2008
    • 1104

    #2
    Originally posted by mavishou View Post
    Hi guys,

    I want to know whether my command line is right? I mean whether 0x100 is the right parameter to extract multi-mapped reads.
    It could be. Depends on the program that created the BAM file. In other words perhaps the program thought that *all* matches were primary and thus never set the 0x100 ("the alignment is not primary") flag.

    I suggest that, since you know the names of some of the reads that have multiple mappings, you look through the BAM file for those reads and see what flags are being set for those reads.

    Comment

    • Marie_Noir
      Junior Member
      • Jul 2011
      • 8

      #3
      I have the same issue to work on. I know that there are multi-mapped reads in my alignment

      grep -i XA:Z:chr15 S1_unsorted.sam | wc -l
      118242
      but samtools view -f100 -c gives me 0

      Checking the lines with XA:Tag

      118242

      grep -i XA:Z:chr15 S1_unsorted.sam | head -n 10
      61WG6AAXX_1:1:1205:11675 0 chr15 28901805 23 76M * 0 0 GCCTCCTGAGTGGCTGGGATTACGGTGTGTGCCACCACGCCTGGCTACTTTTGTCTTTTTAGTAGAGCTGG
      GGGTT eeeceadd^deeceedd^T\\cc`ccddLTc\cTccTc\ceeec\baYYYbb^KKacYc[R^TTaL]L]Y```\Lc XT:A:U NM:i:3 X0:i:1 X1:i:1 XM:i:3 XO:i:0 XG:i:0 MD:Z:XA:Z:chr15,-20643137,76M,4
      ;
      shows that actually the FLAG is not set. Question is, why not??!

      Comment

      • wzchang
        Junior Member
        • Jun 2013
        • 1

        #4
        You need give the right FLAG number 0x100 or 256, Both should work.

        Originally posted by Marie_Noir View Post
        I have the same issue to work on. I know that there are multi-mapped reads in my alignment



        but samtools view -f100 -c gives me 0

        Checking the lines with XA:Tag

        118242



        shows that actually the FLAG is not set. Question is, why not??!

        Comment

        • ashmc
          Junior Member
          • Nov 2016
          • 1

          #5
          Hello,

          How would I get all the other locations in the genome where a particular read maps? If I use the 256 flag, it seems to only give a secondary alignment. I would like to rank the reads such that I can find the top 10 reads (top 10 that map to the most places in the genome).

          Thanks

          Comment

          • BnaT
            Member
            • Nov 2014
            • 10

            #6
            Originally posted by ashmc View Post
            Hello,

            How would I get all the other locations in the genome where a particular read maps? If I use the 256 flag, it seems to only give a secondary alignment. I would like to rank the reads such that I can find the top 10 reads (top 10 that map to the most places in the genome).

            Thanks
            If you only need to check a single read or a few, you could use BLAST. Otherwise, you could try bwa-mem with -a option to get the secondary alignments. Also you could try GEM-mapper which in default outputs all secondary alignments given a maximum threshold of mismatch (e.g 4% of the read length).

            Comment

            Latest Articles

            Collapse

            • mylaser
              Reply to Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
              by mylaser
              Kheloyaar: The Complete Guide to Kheloyaar Loginand Kheloyaar ID
              The online gaming industry has transformed the way people enjoy digital entertainment. As technology continues to improve, players are looking for platforms that offer convenience, security, and a seamless user experience. Kheloyaarhas gained attention among users who value an easy-to-use platform, quick account access, and a simple registration process.
              Whether you're exploring Kheloyaar for the first time or want to understand...
              Yesterday, 09:27 PM
            • SEQadmin2
              Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
              by SEQadmin2



              Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
              ...
              Yesterday, 11:10 AM
            • SEQadmin2
              Cancer Drug Resistance: The Lingering Barrier to Rising Survival
              by SEQadmin2



              Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

              There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
              07-08-2026, 05:17 AM

            ad_right_rmr

            Collapse

            News

            Collapse

            Topics Statistics Last Post
            Started by SEQadmin2, Yesterday, 10:04 AM
            0 responses
            8 views
            0 reactions
            Last Post SEQadmin2  
            Started by SEQadmin2, 07-08-2026, 10:08 AM
            0 responses
            7 views
            0 reactions
            Last Post SEQadmin2  
            Started by SEQadmin2, 07-07-2026, 11:05 AM
            0 responses
            11 views
            0 reactions
            Last Post SEQadmin2  
            Started by SEQadmin2, 07-02-2026, 11:08 AM
            0 responses
            31 views
            0 reactions
            Last Post SEQadmin2  
            Working...