Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • Chirag
    Member
    • Nov 2011
    • 23

    QC Filter FLag:

    Hi,

    Could somebody help me in understanding this,

    In my pair-end data (raw fastq), i found some sequences with bad QC Filter Flag (Where N:Y indicates Good:Bad)

    cat R1.fastq | grep :Y | wc -l
    701834
    cat R2.fastq | grep :Y | wc -l
    701834

    @HWI-1KL114:350CGTACXX:4:1101:2523:1980 1:Y:0:CGATGT
    @HWI-1KL114:350CGTACXX:4:1101:6456:1995 1:Y:0:CGATGT


    How do i remove these ?

    I tried using fastx_toolkit

    fastq_quality_filter -i R1.fastq -o Test_R1.fastq

    It gives me error:
    fastq_quality_filter: Invalid quality score value (char '#' ord 35 quality value -29) on line 80


    @HWI-1KL114:350CGTACXX:5:1101:1983:1985 2:N:0:TGACCA
    CTGGCTTCTTACTCCGTTCAGTCTGAGCTTGGAGATTATAACCCGGGAAC
    +
    =B@DDEFDFH>DFEIJEHFGHCHHG@H@FH9ECGCFFEAFFD?DHG#### [Line 80]


    Could somebody please help me with this.
    Thank you for your help in advance !

    regards
    CN
  • kmcarr
    Senior Member
    • May 2008
    • 1181

    #2
    This was a problem when Illumina first released CASAVA 1.8 (or was it 1.7, I can't remember). The default behavior, with not way to bypass, was to mix passed (:N and failed (:Y reads in the output file. Here is the recommendation from Illumina on how to filter failed reads from the file:

    Code:
    grep -A3 '^@.* [^:]*:N:[^:]*:' [I]your_input_file[/I] | grep -ve '^--$' > [I]your_output_file[/I]
    The first grep statement searches for headers with :N: in the appropriate place and prints that line plus the 3 following lines (sequence, qual header and qual). The second grep statements removes the '--' lines which the first grep inserts between blocks of matches.

    Comment

    • Chirag
      Member
      • Nov 2011
      • 23

      #3
      Thank you Kmcarr !!

      It removed all those sequences without bad QC quality flag.

      #First, i filtered:
      grep -A3 '^@.* [^:]*:N:[^:]*:' Embryo_R1.fastq | grep -ve '^--$' > Emb_R1.fastq


      #Check if BAD flag
      cat Emb_R1.fastq | grep :Y | wc -l
      0 [None]

      Then i try to filter these RAW read using flastq_quality_filter

      fastq_quality_filter -i Emb_R1.fastq -o Test.fastq
      fastq_quality_filter: Invalid quality score value (char '#' ord 35 quality value -29) on line 12

      How could i solve this error ?

      Thank you !

      Comment

      • Krish_143
        Member
        • Jan 2012
        • 45

        #4


        Check this once..
        Quality filtering and PCRduplicate removal
        Krishna

        Comment

        • kmcarr
          Senior Member
          • May 2008
          • 1181

          #5
          Originally posted by Chirag View Post

          Then i try to filter these RAW read using flastq_quality_filter

          fastq_quality_filter -i Emb_R1.fastq -o Test.fastq
          fastq_quality_filter: Invalid quality score value (char '#' ord 35 quality value -29) on line 12

          How could i solve this error ?

          Thank you !
          This has to due with the way in which the quality score is encoded on your fastq file, that is if the character offset is phred+33 or phred+64. (Check out the Wikipedia article for a detailed explanation.) The Fastx toolkit programs default to the assumption that the encoding is phred+64 but Illumina now uses phred+33. You need to tell fastq_quality_filter to use 33.

          Code:
          fastq_quality_filter -Q33 -i Emb_R1.fastq -o Test.fastq

          Comment

          • Chirag
            Member
            • Nov 2011
            • 23

            #6
            Thank you very much !!!

            Comment

            Latest Articles

            Collapse

            • SEQadmin2
              Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
              by SEQadmin2



              Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
              ...
              07-09-2026, 11:10 AM
            • SEQadmin2
              Cancer Drug Resistance: The Lingering Barrier to Rising Survival
              by SEQadmin2



              Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

              There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
              07-08-2026, 05:17 AM
            • GATTACAT
              Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
              by GATTACAT
              Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
              07-01-2026, 11:43 AM

            ad_right_rmr

            Collapse

            News

            Collapse

            Topics Statistics Last Post
            Started by SEQadmin2, 07-13-2026, 10:26 AM
            0 responses
            26 views
            0 reactions
            Last Post SEQadmin2  
            Started by SEQadmin2, 07-09-2026, 10:04 AM
            0 responses
            35 views
            0 reactions
            Last Post SEQadmin2  
            Started by SEQadmin2, 07-08-2026, 10:08 AM
            0 responses
            22 views
            0 reactions
            Last Post SEQadmin2  
            Started by SEQadmin2, 07-07-2026, 11:05 AM
            0 responses
            34 views
            0 reactions
            Last Post SEQadmin2  
            Working...