Newbie Tophat/Bowtie Problem

[esyl]

Hi all,

I'm trying to learn how to analyze my RNA-seq data using TopHat/Bowtie. After running the tophat command, I got the following problem..can anyone help me out? Thanks a bunch!!!

[2013-01-14 06:26:25] Preparing reads
left reads: min. length=49, max. length=49, 42714078 kept reads (131849 discarded)
[2013-01-14 06:37:38] Mapping left_kept_reads to genome mm9_c with Bowtie
[FAILED]
Error running bowtie:
Too few quality values for read: 1CGZ
are you sure this is a FASTQ-int file?

[chadn737]

It sounds like there is an issue with your FASTQ file. Specifically, I am guessing that one or more of your reads has fewer quality scores than there are base pairs.

The FASTQ format looks something like this

@XXXX
TAGATTTCANAAGAATTGGCTTAGTGAAATCCCATATTTCGTATATAAGAAAAAGGAATAATCCGCCGGATTCGGGATTGATCTCTGCAGATTCCGT
+XXXX
gggggggccBcccccccggggggfgggggggggggggggggggggggggggggggeggegggegggeegegggfggegggggggggggggggggged

The first line being the read name, second line being the sequence, third line being the read name again, and the fourth being your quality scores for that read. For each base pair in line two there should be a corresponding quality score in line 4.

So it sounds like for read 1CGZ there are fewer characters in line 4 than in line 2 and that is probably your problem.

To check if this is the case, pull up that read using grep

grep -A 3 1CGZ input.fastq

Then check to see if there is the same number of characters in line 4 as in line 2. If there isn't then that is the problem.

Did you do any kind of processing, like trimming, that may have effected it before you tried aligning?

[esyl]

Thanks for your quick reply!

No I haven't done any trimming and the input FASTQ file is unprocessed...could that be a problem? What program do you use to trim?

Thanks again!

[chadn737]

First try using grep to pull out the read and post that here.

[esyl]

There doesn't seem to be a 1CGZ sequence in the file. After grep there was nothing...