Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • skmotay
    Member
    • Oct 2014
    • 29

    #1

    Inputting fastq files into Tophat2 without info on seq platform type

    I'm trying to use Tophat2 in galaxy to map paired reads, but the drop key for selecting the files doesn't recognize any files imported (files look fine using fastqc). It only recognizes them after running fastq groomer.

    I don't know the platform used to sequence these, so I don't know what to use for running fastq groomer. I tried illumina 1.3-1.7 and then separately sanger/illumina. But then when I used tophat to map either sets of files, the mapping results were terrible. For illumina1.3, it gave me 94.7 discordant alignments. For sanger/illumina, it gave me 0% mapped reads. I'm assuming the problem is the file type I'm converting? The data have been used before for RNA seq DGE analysis, so I'm assuming they're fine.

    My question: how can I know from the original fastq file what to put for the fastq groomer? Or: any helpful information.

    Original fastq files (top line):
    GWZHISEQ02:321YMKACXX:4:1101:1856:1996 1:N:0:ATCACG
    CACGATGATGGCCTTCGACGGCAAGTACGACTTCCCCCTGGACATCAGCGA
    +
    @@CFDDFFHHHHHJJHJIIIJDIJJDGHIIJJJIJJJJJIJIJJJGJJJHH
  • Brian Bushnell
    Super Moderator
    • Jan 2014
    • 2709

    #2
    Those are Illumina reads, and could be either ASCII-64 (old Illumina) or ASCII-33 (Sanger) format; most likely ASCII-64 but I can't tell from that read. It may be possible if you post some more reads (particularly if you can find a read with an 'N' base call).

    Comment

    • skmotay
      Member
      • Oct 2014
      • 29

      #3
      Here's one with several Ns:

      @GWZHISEQ02:321YMKACXX:5:1101:5470:1986 1:N:0:ATCACG
      CTGGATATCAATAATGCTCTCCNTAGGGATATTTCCCGCAAATTTGANNNN
      +
      CCCFFFFFHHHHHJJJJJJJJJ#3AGIJJJJJJJJJJJJJJJJJJJJ####

      Comment

      • Brian Bushnell
        Super Moderator
        • Jan 2014
        • 2709

        #4
        That's strange, normally N should be Q0 (!) not Q2 (#), but it appears to be ASCII-33 (Sanger) data. I'm not sure why the reads are not mapping. You may want to BLAST some of them to a database like NT to make sure they come from the correct organism.

        Comment

        • GenoMax
          Senior Member
          • Feb 2008
          • 7142

          #5
          You should not need to "groom" the data if they are already Sanger formatted. Just choose the "pencil" edit icon against the name of the dataset and manually set the data type to "fastqsanger" under "datatype" tab.

          You should do some QC/trimming though as that may be affecting your alignments.

          Comment

          • skmotay
            Member
            • Oct 2014
            • 29

            #6
            I'm wondering if maybe they need to be adapter-trimmed? They all failed Kmer in fastqc.

            Comment

            • Brian Bushnell
              Super Moderator
              • Jan 2014
              • 2709

              #7
              In that case, probably yes! Though that's easiest to do if you know what kind of adapters were used.

              Comment

              • skmotay
                Member
                • Oct 2014
                • 29

                #8
                Originally posted by GenoMax View Post
                You should not need to "groom" the data if they are already Sanger formatted. Just choose the "pencil" edit icon against the name of the dataset and manually set the data type to "fastqsanger" under "datatype" tab.
                I changed the dataset type to fastqsanger, but Tophat2 and Trimmomatic are still not recognizing the files. I click the dropkey in either program (ex: RNA-Seq FASTQ file, forward reads) and there's nothing there.

                Edit: This is true for either paired-end (which is correct for my data) or single-end options.

                SOLUTION: I am dumb. Accidentally changed them to fastqCsanger
                Last edited by skmotay; 10-08-2014, 12:44 PM.

                Comment

                Latest Articles

                Collapse

                • SEQadmin2
                  New Genomics Technologies Take Aim at Long-Standing Limits
                  by SEQadmin2


                  Researchers using sequencing and genomics tools often have to make trade-offs. They can choose between speed or scale, short reads or long-range information, or targeted panels or a view of the whole transcriptome. New technologies that have been released this year are built to address those tough choices.

                  We asked six companies the same four questions to learn about their latest products. The new technologies bring a lot to the table, including rethinking sequencing
                  ...
                  Today, 10:25 AM
                • SEQadmin2
                  How Immunogenomics Decodes Immunity’s Genetic Blueprint
                  by SEQadmin2




                  The immune system’s power comes from its genetic diversity, allowing myriad threats to be neutralized through first recognizing foreign antigens. That diversity is also what makes the immune system so difficult to study. Recent advances in sequencing technology and computational biology, however, are giving researchers new tools to understand immune responses and immune-related diseases in greater detail.

                  This convergence of genetics, immunology, and computation...
                  09-01-2026, 05:41 AM

                ad_right_rmr

                Collapse

                News

                Collapse

                Topics Statistics Last Post
                Started by SEQadmin2, 09-25-2026, 09:06 AM
                0 responses
                27 views
                0 reactions
                Last Post SEQadmin2  
                Started by SEQadmin2, 09-23-2026, 11:05 AM
                0 responses
                24 views
                0 reactions
                Last Post SEQadmin2  
                Started by SEQadmin2, 09-18-2026, 11:37 AM
                1 response
                45 views
                0 reactions
                Last Post pekgio
                by pekgio
                 
                Started by SEQadmin2, 09-16-2026, 10:23 AM
                1 response
                55 views
                0 reactions
                Last Post pekgio
                by pekgio
                 
                Working...