Tophat's accepted_hits.sam reports all the ISIZEs equal zero

ruping

Member

Join Date: Jul 2010

Posts: 11
- Share
- Tweet
#1

Tophat's accepted_hits.sam reports all the ISIZEs equal zero

07-29-2010, 03:05 PM

Hi, I run tophat for pair-end reads, but the results report all the ISIZE equal 0, which is quite confusing:

read1 99 chr1 26773653 255 36M = 26773726 0 GGGATCCCACCCTGGGGACCCCCACGATTGGCCACC ;<A555?<;?6C@D-5@...
read2 147 chr1 26773726 255 36M = 26773653 0 TCACCTCTCTCAGAGCATCTGGCTGTTTAGCAGAAC 3C0@C=C@?-C=?A?C@...
read3 137 chr1 27542972 255 36M * 0 0 GCCTATCCCCATTGGTGTGCATATGCTGTGTGCAGG 3,?33807;*;2;;,>B;B))*756...

based on the definition of ISIZE, if the two reads in a pair are mapped to the same reference, ISIZE should be calculated, why it's all zero here?

Thanks in advance for help.

Last edited by ruping; 07-30-2010, 03:24 AM.
Tags: None

Previous template Next

From Collection to Sequencing: Why Sample Preparation and Preservation Define Sequencing Data

by SEQadmin2

Data variability is still an issue in sequencing technologies despite the advances in reproducibility and accuracy of these platforms. But the problem does not originate in the sequencing itself, but in the previous steps, before the sample reaches the sequencer.

The first step is collection, followed by preservation and sample preparation for analysis. Most scientists overlook those steps, but not being careful might just be skewing the experiment’s results.
...
- Channel: Articles
Yesterday, 10:05 AM
Single-Cell Sequencing at an Inflection Point: Early Impacts of New Platforms and Emerging Trends

by SEQadmin2

With the launch of new single-cell sequencing platforms in 2026, the field stands at an exciting inflection point. This article surveys the most impactful advances in the field and discusses how they’re reshaping research in cancer, immunology, and beyond.

Introduction

Single-cell sequencing technologies have undergone remarkable advances over the past decade, transitioning from low-throughput experimental approaches to highly scalable platforms capable of...
- Channel: Articles
05-22-2026, 06:42 AM
Environmental Genomics in the Age of NGS: From Microbes to Conservation Strategies

by SEQadmin2

Studying ecosystems means dealing with complex, multi-species communities that are hard to observe at scale. This complexity, however, hides many important questions to be answered, from how biogeochemical cycles work and how climate change can affect species distribution to how conservation strategies can work best.

Genomics, particularly since the expansion of NGS, has transformed ecosystem ecology. By sequencing environmental DNA, we can now assess biodiversity without direct...
- Channel: Articles
05-06-2026, 09:04 AM

Topics	Statistics	Last Post
Long-Read RNA Sequencing Uncovers a Hidden Layer of Immune Cell Regulation by SEQadmin2 Started by SEQadmin2, Yesterday, 12:03 PM	0 responses 19 views 0 reactions	Last Post by SEQadmin2 Yesterday, 12:03 PM
DNA Methylation Study Reveals How Epigenetic Changes Pass Between Generations by SEQadmin2 Started by SEQadmin2, Yesterday, 11:40 AM	0 responses 14 views 0 reactions	Last Post by SEQadmin2 Yesterday, 11:40 AM
MetaBeeAI Helps Scientists Process Research Literature Faster by SEQadmin2 Started by SEQadmin2, 05-28-2026, 11:40 AM	0 responses 29 views 0 reactions	Last Post by SEQadmin2 05-28-2026, 11:40 AM
Scientists Solve a 25-Year Mystery in RNA Interference by SEQadmin2 Started by SEQadmin2, 05-26-2026, 10:12 AM	0 responses 31 views 0 reactions	Last Post by SEQadmin2 05-26-2026, 10:12 AM

Unconfigured Ad

Tophat's accepted_hits.sam reports all the ISIZEs equal zero

Latest Articles

ad_right_rmr

News