Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • daanum
    Member
    • Nov 2015
    • 24

    Trimmomatic Unpaired files

    Hi,

    I run the following command in Trimmomatic:
    java -jar /home/devgen/bin/trimmomatic-0.36.jar PE -phred33 C95VLANXX-2046D-01-01-01_L003_R1.fastq C95VLANXX-2046D-01-01-01_L003_R2.fastq N6_F_P.fastq N6_F_U.fastq N6_R_P.fastq N6_R_U.fastq ILLUMINACLIP:adapters/TruSeq3-PE.fa:2:30:10 MINLEN:25 AVGQUAL:20 -trimlog N6L3.log

    Am I running it correctly?

    I have RNASeq Paired end data from HiSEq2500.

    The output looks like this:

    TrimmomaticPE: Started with arguments:
    -phred33 C95VLANXX-2046D-01-01-01_L003_R1.fastq C95VLANXX-2046D-01-01-01_L003_R2.fastq N6_F_P.fastq N6_F_U.fastq N6_R_P.fastq N6_R_U.fastq ILLUMINACLIP:adapters/TruSeq3-PE.fa:2:30:10 MINLEN:25 AVGQUAL:20 -trimlog N6L3.log
    Using PrefixPair: 'TACACTCTTTCCCTACACGACGCTCTTCCGATCT' and 'GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT'
    ILLUMINACLIP: Using 1 prefix pairs, 0 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
    Input Read Pairs: 16228554 Both Surviving: 12432585 (76.61%) Forward Only Surviving: 3793730 (23.38%) Reverse Only Surviving: 1926 (0.01%) Dropped: 313 (0.00%)
    TrimmomaticPE: Completed successfully

    ---------
    Is it normal to get only 76% surviving in both reads? What do I do with the upaired ones? Unpaired forward file has 23% of reads which is quiet a lot. Should I just leave this file and only use paired-survived file for alignment with tophat2?


    Any advise will be greatly appreciated.

    Thanks.
  • daanum
    Member
    • Nov 2015
    • 24

    #2
    Any suggestions on this will be greatly appreciated.

    Comment

    • Brian Bushnell
      Super Moderator
      • Jan 2014
      • 2709

      #3
      Well... if I recall correctly, the default behavior of Trimmomatic when adapters are discovered is to drop one of the reads, because it will simply be the reverse-complement of its mate. I think it is possible to disable this behavior, which would make things simpler as you would then have only paired reads as output. The default behavior of BBDuk when adapter-trimming is to trim and output both reads in the pair, so that you don't end up with singletons unnecessarily.

      You CAN use both the paired and singleton reads for alignment - and generally, you should, unless you already have plenty of coverage - but it's even better, in my opinion, to simply not discard mates in the first place when you don't have to.

      Comment

      • daanum
        Member
        • Nov 2015
        • 24

        #4
        Thanks. I did not understand this when you say trimmomatic keeps paired reads when option keepbothreads is set to 'true'.could you please graphically explain what it does? I am new to rnaseq so please excuse my silly questions.
        Thanks

        Comment

        • jackfrost
          Junior Member
          • Jun 2015
          • 9

          #5
          Originally posted by daanum View Post
          Thanks. I did not understand this when you say trimmomatic keeps paired reads when option keepbothreads is set to 'true'.could you please graphically explain what it does? I am new to rnaseq so please excuse my silly questions.
          Thanks
          They do a pretty good job in the manual (TrimmomaticManual_V0.32.pdf) with explaining each step including graphics which is often helpful. Its probably a good idea to become familiar with each step so you can use the program most appropriately based on the specifics of your data and your experiment. From my experience this is time always well spent when using a new bioinformatics tool. Good luck.

          Comment

          Latest Articles

          Collapse

          • GATTACAT
            Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
            by GATTACAT
            Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
            07-01-2026, 11:43 AM
          • SEQadmin2
            Nine Things a Sample Prep Scientist Thinks About Before Sequencing
            by SEQadmin2


            I’m not a sequencing expert. I’m a purification scientist who uses NGS to evaluate workflows my group develops. With this perspective, we think about the sample first and the NGS workflow second. The sequencer is an exceptionally honest reporter, but it can only report on what you give it, so whether you get clean, interpretable data from an NGS workflow is largely determined before you begin.

            Here are nine questions we think about, in roughly the order they matter, before...
            06-18-2026, 07:11 AM

          ad_right_rmr

          Collapse

          News

          Collapse

          Topics Statistics Last Post
          Started by SEQadmin2, 07-02-2026, 11:08 AM
          0 responses
          9 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 06-30-2026, 05:37 AM
          0 responses
          13 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 06-26-2026, 11:10 AM
          0 responses
          20 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 06-17-2026, 06:09 AM
          0 responses
          54 views
          0 reactions
          Last Post SEQadmin2  
          Working...