Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Cufflinks SAM file sort problem

    The Cufflinks manual states that SAM files should be sorted according to the following:
    Code:
    sort -k 3,3 -k 4,4n hits.sam > hits.sam.sorted
    However, when I sort this way, the chromosomes are sorted something like this:
    Code:
    chr1
    chr11
    [...]
    chr19
    chr2
    chr20
    chr3
    [...]
    chr9
    I assume the intention of the sort is to end up with chr1 ... chr20, chrX, in numerical order? If so, how can I achieve this? I tried using various flags for field 3, and I also tried making "chr" a delimiter, but it seems delimiters must be one character long.

    I've been running Cufflinks with my SAM files ordered like this, but I've no idea if it will make a difference or not.

    Note: I started with Bioscope BAM files (PE, strand-specific), which were converted to SAM with SAMtools. The 'XS:A:' field was added based on strand info from field 2. A sample of my SAM files is below:
    Code:
    1384_723_1125   0       chr1    121     0       25M     *       0       0       CATTTTCCTCTAGAGTCAGAAACGN       IH8IIIIIIIIIEII77IIIIHEI!
           NH:i:0  RG:Z:20100828211420290  CS:Z:G3130002022232221112200133 CQ:Z:BB'2BBB?2BB?42BB776BA:/75  SM:i:0  CM:i:2  XS:A:+  
    200_1536_1533   73      chr1    7467    1       18H28M4H        *       0       0       GTTTTTCCTAATTTGATATTTAAAAAAA    //-.2.**787;033""".*)--4F>.,    NH:i:0  RG:Z:20100828211420290  CS:Z:T12132211201311202001000020230300122130030000002000        CQ:Z:6??<=?><;A;AA?/-%,)')%*)&%&2'1+&.&%))&%%)%07('&2-* SM:i:2  CM:i:2  XS:A:+  
    2234_1292_1060  129     chr1    8334    33      25M     chr8    47073575        0       GAGATCCCCAAGAATCCTTACCTTT       +EIII))))519IIIA5:8/%:D4&       NH:i:1  RG:Z:20100828211420290  CS:Z:G0222320001022032020320200 CQ:Z:'%ABB<)=>)-%5=B=%1*/<%6/&  SM:i:1  CM:i:3  XS:A:+  
    21_385_199      89      chr1    10073   0       3H27M20H        *       0       0       AGCCCCGAAAAAAAAAATAAATATCAG     72/@I91=B?@4/03E@<II%%,/(0I     NH:i:0  RG:Z:20100828211420290  CS:Z:T01223203301132231023222233100330000000002300032030        CQ:Z:&,87'*/%%%.*-((/%&+*5:0((%%684)8.&+%01/4*(28)',,)6 SM:i:3  CM:i:2  XS:A:-
    Can anyone clarify this issue for me? Thanks.

  • #2
    If cufflinks runs then you shouldn't have any problems arising from the sorting. It sorted the chromosomes as strings, not as numbers, but as long as the positions are sorted numerically, it should be fine, and they are (it would have given you an error otherwise)

    Comment


    • #3
      Thanks for your reply. I wasn't sure whether Cufflinks would continue in the wrong way or give an error message, had it been wrong.

      Comment

      Latest Articles

      Collapse

      • seqadmin
        Current Approaches to Protein Sequencing
        by seqadmin


        Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...
        04-04-2024, 04:25 PM
      • seqadmin
        Strategies for Sequencing Challenging Samples
        by seqadmin


        Despite advancements in sequencing platforms and related sample preparation technologies, certain sample types continue to present significant challenges that can compromise sequencing results. Pedro Echave, Senior Manager of the Global Business Segment at Revvity, explained that the success of a sequencing experiment ultimately depends on the amount and integrity of the nucleic acid template (RNA or DNA) obtained from a sample. “The better the quality of the nucleic acid isolated...
        03-22-2024, 06:39 AM

      ad_right_rmr

      Collapse

      News

      Collapse

      Topics Statistics Last Post
      Started by seqadmin, 04-11-2024, 12:08 PM
      0 responses
      15 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 04-10-2024, 10:19 PM
      0 responses
      21 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 04-10-2024, 09:21 AM
      0 responses
      16 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 04-04-2024, 09:00 AM
      0 responses
      44 views
      0 likes
      Last Post seqadmin  
      Working...
      X