[sameet]

Yes.

You can also use fastx_clipper to trim and fastx_collapser to collapse the reads if you want.

There's a few web based tools you can plug in your collapsed sequences and counts and get some results... I'm trying them now and reading the papers just to see how they are and what they do, I might do something myself also, but it's easy enough to plug and chug. mirAnalyzer, mirTools, and DSAP.

Hi,
Can you point me to the specific papers that you mention?

[mgogol]

Here's the sites, the papers should be linked from these.

http://web.bioinformatics.cicbiogune.es/microRNA/miRanalyser.php

http://dsap.cgu.edu.tw/dsap.html

http://centre.bioinformatics.zj.cn/mirtools

[sameet]

Hi,
I have looked at the cutadpt. But in the help the sequence for the Illumina 5' primer is not given. Is that sequence or model for 5' primer already built-in in cutadapt. If not is that sequence available.

I am also trying novoalign, will post my experience about it soon.

[mgogol]

In the data I'm currently looking at, the thing to trim was

ATCTCGTATGCCGTCTTCTGCTTGT

but your mileage may vary. This may help, or also just looking at some reads in the fastq file.

[sparks]

Hi,

I was wondering about one more question. If the adaptors are trimmed, would you get the final 'usable' (for the lack of better word) sequences of different lengths?

Yes, you'd get trimmed reads of different length. Some aligners can handle this (eg Novoalign) some can't (e.g. MAQ)

Colin

[sameet]

In the data I'm currently looking at, the thing to trim was

ATCTCGTATGCCGTCTTCTGCTTGT

but your mileage may vary. This may help, or also just looking at some reads in the fastq file.

That was very helpful. I think this is exactly what I was looking for. Thank you.

[sameet]

I think the following link is the most comprehensive list of all the primers as far as SOLEXA/Illumina is concerned.

http://intron.ccam.uchc.edu/groups/tgcore/wiki/013c0/Solexa_Library_Primer_Sequences.html

[sameet]

Hi Sameet,
Novoalign will trim adapters and align miRNA in one go. It's also pretty fast even free version with no multi-threading as reads are usually aligned with at most one mismatch.
Novoalign also looks for precursor location, giving a score and location for nearby complementary alignment.
Steps:
1. index genome
novoindex ref.idx ref.fasta
2. Align the miRNA
novoalign -d ref.idx -a -m -t 30 -f reads.fastq

Colin

This solutions seems to be working perfectly. I dont have an idea of how long it should take. But it did remove the adaptors and i am getting an output file that looks to contain a lot of reads that are of differing lengths.

[bharat_iyengar]

I had been doing fair amount of RNAseq and small RNAseq analysis but I still have a basic doubt regarding small RNAseq.

for RNAs smaller than the typical read length, where do the extra bases come from. They dont seem to have any common sequence which I might consider as adapter.