Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • ECHo
    Member
    • Jan 2010
    • 17

    #1

    SAM file for paired-end

    I've aligned the Solexa data with tophat.
    After doing the alignment, I got the bam file.
    Since I want to find some fusion junction, which contains two different genes in one read, I have to search from the bam file.
    I first transform the bam to sam.
    Part of the sam file would be as follows:
    HWUSI-EAS1812:1:100:10011:5732#0 147 chr6 63921573 3 76M = 63921570 0 GATTCCTCCCGGGACAGAAACAAGCCCTTTAAGTTTATGCTAGGCAAGCAGGAGGTGATCCGAGGCTGGGAAGAAG ghhghhghghhhhgfhhhhhhhghgghhhhhhhhchhffhahhhhhhhhhhhhhhghhhgfhhhhhfhhhhhhhhh NM:i:0 NH:i:2
    HWUSI-EAS1812:1:100:10011:5732#0 163 chr20 1356146 3 76M = 1356149 0 CTTCTTCCCAGCCTCGGATCACCTCCTGCTTGCCTAGCATAAACTTAAAGGGCTTGTTTCTGTCCCGGGAGGAATC hhhhhhhhhfhhhhhfghhhghhhhhhhhhhhhhhahffhhchhhhhhhhgghghhhhhhhfghhhhghghhghhg NM:i:0 NH:i:2 CC:Z:chr6 CP:i:63921573
    HWUSI-EAS1812:1:100:10011:5732#0 83 chr20 1356149 3 76M = 1356146 0 CTTCCCAGCCTCGGATCACCTCCTGCTTGCCTAGCATAAACTTAAAGGGCTTGTTTCTGTCCCGGGAGGAATCAAA gefhhhhhhhhhhhhhhdghhhhhhhhhhhhhhhhhhhhghhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh NM:i:0 NH:i:2 CC:Z:chr6 CP:i:63921570
    HWUSI-EAS1812:1:100:10011:5732#0 99 chr6 63921570 3 76M = 63921573 0 TTTGATTCCTCCCGGGACAGAAACAAGCCCTTTAAGTTTATGCTAGGCAAGCAGGAGGTGATCCGAGGCTGGGAAG hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhghhhhhhhhhhhhhhhhhhhhgdhhhhhhhhhhhhhhfeg NM:i:0 NH:i:2

    Well, I just want to find the paired-end two reads pair, and I want to analyze the CIGAR term.
    I'm not sure why the Read name(HWUSI-EAS1812:1:100:10011:5732#0) include so many different positions.
    It's quite weird.

    Could anybody explain their meanings?
    Thanks a lot.

Latest Articles

Collapse

  • SEQadmin2
    How Immunogenomics Decodes Immunity’s Genetic Blueprint
    by SEQadmin2




    The immune system’s power comes from its genetic diversity, allowing myriad threats to be neutralized through first recognizing foreign antigens. That diversity is also what makes the immune system so difficult to study. Recent advances in sequencing technology and computational biology, however, are giving researchers new tools to understand immune responses and immune-related diseases in greater detail.

    This convergence of genetics, immunology, and computation...
    Yesterday, 05:41 AM
  • SEQadmin2
    Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
    by SEQadmin2



    CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

    Despite this, “CRISPR helped turn genome editing from a specialized technique into
    ...
    07-31-2026, 11:01 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by SEQadmin2, 08-24-2026, 10:32 AM
0 responses
42 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 08-20-2026, 11:17 AM
0 responses
48 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 08-18-2026, 10:05 AM
0 responses
55 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 08-13-2026, 12:22 PM
0 responses
50 views
0 reactions
Last Post SEQadmin2  
Working...