Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Help needed to prepare consensus including overhangs (non overlapping reads)!

    Hi, I am new to programming and bioinformatics. I am having trouble merging my pre-trimmed fastq files to merge with the inclusion of the overhangs/nonoverlapping reads at either end. I tried PEAR before, which gave me final consensus only for the overlapping region. I tried bbmerge and it gave me the same thing. And I am not able to figure out what script I should use to have the final consensus that includes overhangs added to ends of my consensus so I have the full consensus sequences. For example, I have following fastq reads. Could any expert help me with a custom script for this? thanks.

    @S1_A01_015_F
    ATTTATTTTTGGTGCTTTTTCTGGTGTAGTAGGAACTACATTATCTGTTTTAATTAGAATGGAATTAGCACAACCCGGTAATCAAATTTTTGCTGGGAATCATCATTTATATAATGTTGTTGTTACAGCACATGCATTTATTATGATTTTTTTTATGGTTATGCCTGTTTTAATAGGTGGTTTTGGTAATTGGTTTGTACCTTTAATGATTGGTGCTCCAGATATGGCTTTTCCTCGTATGAATAATATAAGTTTTTGGTTATTACCACCATCATTATTATTATTAGTTTCTTCAGCTATTGTTGAATCAGGTGCAGGTACTGGTTGGACTGTATATCCTCCTTTATCAAGTGTACAAGCACATTCAGGTCCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTATCAGGTATTTCTTCTTTATTAGGTGCTATTAATTTTTTATCTACTATTTATAATATGAGAGCTCCAGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGGCTATATTTATTACTGCTTTTTTATTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAACTTAAATACATCTTTTTACGATCCATCAGGCGGAGGAGATCCTGTATTATACCAACATTTATTTTGGTTTTTCGGCAACCCCGGAAG
    +
    9>*%**ROOAB*,78K[[[[W>W:0G6J@RP_J__Y_TPK_W_MRP\\__\\__\\\_W;W___\_\W___\__________\___W____\\_W____\___\_________WK__RW____\__\__________RKWWW__RW__W_WRW________________WWWW_\YW___WWWW______WW_WWW_____W_________________\S______LRRW_____Y____________\_W_________________________________\__________________W________________________________WRRWWW___________________________________________________\_____________________________________________RRR_____________________O_____________________________________________________[[[[R[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[WW[[[[[[[[[[[[[[[[[[[[[R[[[[[[W[T[[[[[[[[[[[[R[[[[[[W[[R[[[MQ[[SO[W[LJB[[HMLWRT[[UPRSSSSJ=ISLM[ISIHKSS>@[IDD''&&&&*<A5-*((5

    @S1_A01_015_R
    CTCCTCGCCTGATGGATCGTAAAAGATGTATTTAAGTTTCTATCAGTTAATAACATAGTAATTGCACCAGCTAATACAGGTAAAGTTAATAATAATAAAAAAGCAGTAATAAATATAGCCCAAACAAATAAAGGTAATCTATGAAAACTTAAACCTGGAGCTCTCATATTATAAATAGTAGATAAAAAATTAATAGCACCTAATAAAGAAGAAATACCTGATAAATGTAAACTAAAAATAGCTAAATCTACTGAAGGACCTGAATGTGCTTGTACACTTGATAAAGGAGGATATACAGTCCAACCAGTACCTGCACCTGATTCAACAATAGCTGAAGAAACTAATAATAATAATGATGGTGGTAATAACCAAAAACTTATATTATTCATACGAGGAAAAGCCATATCTGGAGCACCAATCATTAAAGGTACAAACCAATTACCAAAACCACCTATTAAAACAGGCATAACCATAAAAAAAATCATAATAAATGCATGTGCTGTAACAACAACATTATATAAATGATGATTCCCAGCAAAAATTTGATTACCGGGTTGTGCTAATTCCATTCTAATTAAAACAGATAATGTAGTTCCTACTACACCAGAAAAAGCACCAAAAATTAAATATAAAGTACCTATGTCTTTATGATTTGTTGAAAA
    +
    B*+'2+(0C2W:0[C4'L4(*'*)/=1:?HJ[J<=7____HH_GJI_FS_Y__PP_R___TN_\\T_\M\_\_\\_\OY__\_\_______RR__\_________\__W______\OSYYW_Y___\\\\YCLW_____W_\WW\______\\\\Y_YWYWW___Y\_______W_\SAG<KQY_WRW_____YWQWY\_O\\EYYQN_WC_\Y___\Y_\\__\___\\\_\_\_____Y__\_\__\__YWW_Y_\__\_WQY_Y_Y___\\_\_Y__KYYWLLW_SWWO\___OY\_\Y____\_______\____\__________YYLLWQE_\\___R_____\\\YMYYOOY___________YYYYY\\OOY\\\________N_SRFG__Y\\YYY_YORR_Y__Y__YR___YYYOY__________Y____LYY_OO_Y_____L_Y___YY_________O______________YYLJOYH?=OL___________MU_U___________[NUNMOUURWOQUUUPIIW[OMWOU7?OUUUPWU[[[UUN[WNLW[[WWUWNMU[[U[U[UDLC[QSHRWRSPWQMPQS[VTS[JJPPS[TTTT[[[PQR[[[[[RRJHMRTQQRR[W[R[[LQQSW@MLA9J1QQKL

Latest Articles

Collapse

  • seqadmin
    Current Approaches to Protein Sequencing
    by seqadmin


    Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...
    04-04-2024, 04:25 PM
  • seqadmin
    Strategies for Sequencing Challenging Samples
    by seqadmin


    Despite advancements in sequencing platforms and related sample preparation technologies, certain sample types continue to present significant challenges that can compromise sequencing results. Pedro Echave, Senior Manager of the Global Business Segment at Revvity, explained that the success of a sequencing experiment ultimately depends on the amount and integrity of the nucleic acid template (RNA or DNA) obtained from a sample. “The better the quality of the nucleic acid isolated...
    03-22-2024, 06:39 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, 04-11-2024, 12:08 PM
0 responses
25 views
0 likes
Last Post seqadmin  
Started by seqadmin, 04-10-2024, 10:19 PM
0 responses
28 views
0 likes
Last Post seqadmin  
Started by seqadmin, 04-10-2024, 09:21 AM
0 responses
24 views
0 likes
Last Post seqadmin  
Started by seqadmin, 04-04-2024, 09:00 AM
0 responses
52 views
0 likes
Last Post seqadmin  
Working...
X