Tweet
Hi all,
We are intending to multiplex 10 individuals on a single Illumina lane for PE sequencing, and we have access to Multiplexing Primers, Adapters and Primer Indices previously ordered from Invitrogen (not Illumina) for another project. I have gone through the sequences, comparing them to what's been posted on SEQanswers, but there is only a partial match.
Our Multiplexing Adapters (MA1 and MA2) are:
MA1: 5' P-GATCGGAAGAGCACACGTCT
MA2: 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT
...but there is partial disagreement (in the latter half of the sequence) between MA1 and the adapter posted on some threads (but not others), such as the adapter sequence provided by ECO in a post from 7 April 2008:
5' P-GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG
The same goes for our PCR primer 2
(5' GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT), for which ECO provides a completely different sequence
(5' CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT)
Adapter 1, PCR Primer 1 and the Indices are identical, though, between ECO and us.
I guess I am only trying to make sure we have the correct adapters, and to understand why there can be different sequences out there for what should essentially be the same adapters/primers. Have there been changes along the way?
I would also be very thankful if someone could help me out with an additional question:
For adapter ligation, a mix containing Adapters 1 and 2 needs to be combined with ligase buffer, ligase and the DNA sample. However, what concentrations do the two adaptors need to be in? I wasn't able to find this information anywhere in the Illumina protocol.
Please excuse the rather lengthy inquiry, and I'd be very thankful for any advice.
Cheers
Bjorn
We are intending to multiplex 10 individuals on a single Illumina lane for PE sequencing, and we have access to Multiplexing Primers, Adapters and Primer Indices previously ordered from Invitrogen (not Illumina) for another project. I have gone through the sequences, comparing them to what's been posted on SEQanswers, but there is only a partial match.
Our Multiplexing Adapters (MA1 and MA2) are:
MA1: 5' P-GATCGGAAGAGCACACGTCT
MA2: 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT
...but there is partial disagreement (in the latter half of the sequence) between MA1 and the adapter posted on some threads (but not others), such as the adapter sequence provided by ECO in a post from 7 April 2008:
5' P-GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG
The same goes for our PCR primer 2
(5' GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT), for which ECO provides a completely different sequence
(5' CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT)
Adapter 1, PCR Primer 1 and the Indices are identical, though, between ECO and us.
I guess I am only trying to make sure we have the correct adapters, and to understand why there can be different sequences out there for what should essentially be the same adapters/primers. Have there been changes along the way?
I would also be very thankful if someone could help me out with an additional question:
For adapter ligation, a mix containing Adapters 1 and 2 needs to be combined with ligase buffer, ligase and the DNA sample. However, what concentrations do the two adaptors need to be in? I wasn't able to find this information anywhere in the Illumina protocol.
Please excuse the rather lengthy inquiry, and I'd be very thankful for any advice.
Cheers
Bjorn
