Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • kinvel
    Junior Member
    • Nov 2013
    • 4

    #1

    4C-seq library structure for Illumina sequencing

    I’m in the middle of 4C-seq experiment and now designing primers for final PCR. I did it according to van de Werken protocol (Meth. Enzymol., 2012, 513, 89-112) and my final library structure is expected to be as follows (1):

    5’AATGATACGGCGACCACCGANNNPPPPPPPPPPPPPPAAGCTT<INSERT>PPPPPPPPPPPPPPPPPPPPATCTCGTATGCCGTCTTCTGCTTG

    where from 5': Illumina P5 primer, NNN – trinucleotide index to sort libraries (16 libraries should be sequenced in one run), PPPPP – viewpoint primers, and at 3’ end – the Illumina P7 primer, reverse complemented. Length of each primer is about 43 n.

    The libraries are planned to be sequenced (single end) using Illumina 2500. If I properly understand the technology, after bridge PCR and removing of the P5-anchored fragments, the residual fragments attached to support through P7 will contain the reverse complemented P5 primer at their free ends and are sequenced from P5 primer.

    However, when I discussed this experiment with our local NGS people, I was told that this library structure will not work and I will need custom sequencing primers, and proposed what they call universal adapters. With these adapters, the library structure (without viewpoint primers) should be as shown below (2):

    5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-INSERT-AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG-3’

    I don’t like this structure very much, because it has 60 n adapters, and with addition of my viewpoint primers they will become as long as ~80 n. To add these adapters it will be necessary to use nested PCR, and I would like to minimize the number of PCR cycles.

    So my question is could the libraries with the structure (1) be sequenced using HiSeq 2500 with Illumina P5 primer, or it is necessary to use the universal adapters to prepare libraries with structure (2)?

    Thanks a lot.

Latest Articles

Collapse

  • SEQadmin2
    Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
    by SEQadmin2



    CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

    Despite this, “CRISPR helped turn genome editing from a specialized technique into
    ...
    07-31-2026, 11:01 AM
  • SEQadmin2
    Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
    by SEQadmin2


    Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

    The systematic characterization of the human proteome has
    ...
    07-20-2026, 11:48 AM
  • SEQadmin2
    Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
    by SEQadmin2



    Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
    ...
    07-09-2026, 11:10 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by SEQadmin2, 08-06-2026, 07:41 AM
0 responses
12 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 08-03-2026, 10:13 AM
0 responses
30 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 07-31-2026, 02:55 AM
0 responses
40 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 07-24-2026, 12:17 PM
0 responses
26 views
0 reactions
Last Post SEQadmin2  
Working...