Hello there,
I was advised to use a High-Fidelity polymerase (I used the Phusion High-Fidelity polymerase). Note that the reaction conditions are slightly different using these.
Good luck,
Joze
Seqanswers Leaderboard Ad
Collapse
Announcement
Collapse
No announcement yet.
X
-
Hi there,
I was wondering if anyone could let me know what taq polymerase have they used for the multiplex PCR prior to HiSeq Illumina sequencing? Or what are they ways to chose one
Leave a comment:
-
Hello everyone,
I realise this thread is pretty old now, but would anyone be able to attach the Meyer paper? I can't access it without subscription.
Cheers,
Jo
Leave a comment:
-
Hi. I have my own customized oligos and I would like to anneal them to make adapters. I've seen many protocols (including the Meyer's one) and I am confused whether to use Annealing Buffer with EDTA or without EDTA.
Now I have the oligos in lyophilized form: in which buffer should I resuspend them? H2O or TE or Tris-HCl?
And for Annealing Buffer:
Tris+ NaCl + EDTA? or TrisHCl only?
I will use NEBNext kit to do the ligation. Will EDTA interfere with the ligation process?
Please help. =(
Leave a comment:
-
Originally posted by csmall View PostHi upenn_ngs,
We've been testing your suggested two-primer system using Phusion PCR reagents, but I'm afraid without much success. We know our adapter ligation works, we're just struggling with the PCR. Would you be willing to share the details of your working protocol with us? In particular the primer sequences (with any modifications) and PCR specifications (reagents and cycling conditions) would be of great use to us. Thanks for your contributions and advice!
-CSAttached Files
Leave a comment:
-
Originally posted by upenn_ngs View PostWe have found that the amplification with a three primer system (multiplex pcr 1.0, multiplex pcr 2.0, and pcr primer index #) does not yield good results. This is the original illumina design. However, multiplex pcr 2.0 and the pcr primer index # oligos have homology and can be ordered as a single, longer primer. This two primer system will yield quality indexed libraries.
We've been testing your suggested two-primer system using Phusion PCR reagents, but I'm afraid without much success. We know our adapter ligation works, we're just struggling with the PCR. Would you be willing to share the details of your working protocol with us? In particular the primer sequences (with any modifications) and PCR specifications (reagents and cycling conditions) would be of great use to us. Thanks for your contributions and advice!
-CS
Leave a comment:
-
-
Leave a comment:
-
Hi All,
We are also planning on using the Illumina multiplexing system to sequence restriction fragments on a HiSeq machine. The prior comments seem to indicate that Illumina's 3-primer approach is problematic. If we adopt the suggested 2-primer approach, should I simply combine the PCR Primer 2 and PCR Index Primer sequences, yielding the following oligo design:
5'CAAGCAGAAGACGGCATACGAGATxxxxxxGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT3' ?
If anyone is aware of necessary primer modifications beyond this, I'd really appreciate your advice.
Also, is it possible to use additional index sequences, if I would like more than the 12 designed by Illumina?
Thanks very much!
Leave a comment:
-
Originally posted by upenn_ngs View PostWe have found that the amplification with a three primer system (multiplex pcr 1.0, multiplex pcr 2.0, and pcr primer index #) does not yield good results. This is the original illumina design. However, multiplex pcr 2.0 and the pcr primer index # oligos have homology and can be ordered as a single, longer primer. This two primer system will yield quality indexed libraries.
Thanks for your contributions to the forum. We are trying to multiplex using the two primer system you described. Although we have designed the Universal Primer and a number of Index Primers no problem, we're not completely sure what 5' and 3' primer modifications to these are necessary. So far, we've gathered that the Universal Primer requires a 5' phosphate and a 3' phosphorothioate, while the indexing primers don't require any 5' or 3' modifications. Can you or anyone else who's had luck with this system confirm that this info is correct? Thanks in advance!
Leave a comment:
-
Originally posted by alisrpp View PostThanks upenn_ngs!
But i have a new question.
We didn't knew the "single primer" recommendation at the moment of ordering the stuff so we ordered the primer 1.0, 2.0 and the indexes separately. Do you think that maybe we can do an annealing of the primer 2.0 and the index? Or in our case is better if we just go ahead with the three primer system?
Thanks!
Leave a comment:
-
Thanks upenn_ngs!
But i have a new question.
We didn't knew the "single primer" recommendation at the moment of ordering the stuff so we ordered the primer 1.0, 2.0 and the indexes separately. Do you think that maybe we can do an annealing of the primer 2.0 and the index? Or in our case is better if we just go ahead with the three primer system?
Thanks!
Leave a comment:
Latest Articles
Collapse
-
by seqadmin
In recent years, precision medicine has become a major focus for researchers and healthcare professionals. This approach offers personalized treatment and wellness plans by utilizing insights from each person's unique biology and lifestyle to deliver more effective care. Its advancement relies on innovative technologies that enable a deeper understanding of individual variability. In a joint documentary with our colleagues at Biocompare, we examined the foundational principles of precision...-
Channel: Articles
01-27-2025, 07:46 AM -
ad_right_rmr
Collapse
News
Collapse
Topics | Statistics | Last Post | ||
---|---|---|---|---|
Genetic Mapping of Plasmodium knowlesi Identifies Essential Genes and Drug Resistance Mechanisms
by seqadmin
Started by seqadmin, Today, 09:30 AM
|
0 responses
9 views
0 likes
|
Last Post
by seqadmin
Today, 09:30 AM
|
||
Started by seqadmin, 02-05-2025, 10:34 AM
|
0 responses
18 views
0 likes
|
Last Post
by seqadmin
02-05-2025, 10:34 AM
|
||
Started by seqadmin, 02-03-2025, 09:07 AM
|
0 responses
21 views
0 likes
|
Last Post
by seqadmin
02-03-2025, 09:07 AM
|
||
Started by seqadmin, 01-31-2025, 08:31 AM
|
0 responses
33 views
0 likes
|
Last Post
by seqadmin
01-31-2025, 08:31 AM
|
Leave a comment: