Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • bam file missing barcode and UMI info

    Hi,

    I used STARsolo but my bam files, below, are missing barcode and UMI info:

    ```
    (/scratch/work/malonzm1/.conda_envs/scvi-env) [malonzm1@login3]/scratch/cs/pan-autoimmune/data/star/scRNAseq/GSE151177/SRR11848679% samtools view SRR11848679Aligned.out.bam|head -n5
    NB500961:910:HJ5TWBGXC:1:23304:10007:9225 0 chr1 6100902 255 55M * 0 0 TTCGGAGCCCCCACTGTTTCCCACTCAGCTTTGTGCTCAGATCCCAGGTCCCAAG AAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE NH:i:1 HI:i:1 AS:i:54 nM:i:0 NM:i:0 MD:Z:55 jM:B:c,-1 jI:B:i,-1
    NB500961:910:HJ5TWBGXC:1:13111:23716:1741 0 chr1 6100902 255 4S51M * 0 0 GAGATTCGGAGCCCACACTGTTTCCCACTCAGCTTTGTGCTAATATCCAAGGTCC ///AA/EEE/AEEE//AE/////E/<A<EE/E/AE///E/E/A/EEE</A<AA// NH:i:1 HI:i:1 AS:i:42 nM:i:4 NM:i:4 MD:Z:10C26C1G4C6 jM:B:c,-1 jI:B:i,-1
    NB500961:910:HJ5TWBGXC:1:22211:15746:1375 0 chr1 6100902 255 55M * 0 0 TTCGGAGCCCCCACTGTTTCCCACTCAGCTTTGTGCTCAGATCCCAGGTCCCAAG AAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEEEEEEEEEEEEE NH:i:1 HI:i:1 AS:i:54 nM:i:0 NM:i:0 MD:Z:55 jM:B:c,-1 jI:B:i,-1
    NB500961:910:HJ5TWBGXC:1:13309:24262:17947 0 chr1 6100903 255 55M * 0 0 TCGGAGCCCCCACTGTTTCCCACTCAGCTTTGTGCTCAGATCCCAGGTCCCAAGG AAAAAEAAA/EAEEEEEEE/EEEEEEEEEEEEEEEEAEAEEAEEEEEEEEEEEEE NH:i:1 HI:i:1 AS:i:54 nM:i:0 NM:i:0 MD:Z:55 jM:B:c,-1 jI:B:i,-1​
    ```

    I used the following script:

    ```

    'STAR --outSAMattributes All --outSAMtype BAM Unsorted --quantMode GeneCounts --readFilesCommand gunzip -c --runThreadN %s --sjdbGTFfile %s --outReadsUnmapped Fastx --outMultimapperOrder Random --genomeDir %s --readFilesIn %s %s --outFileNamePrefix %s --soloType CB_UMI_Simple --soloBarcodeReadLength 0 --soloCBwhitelist %s --soloUMIlen %s --soloCBlen %s --soloUMIstart %s'%(NCPU, GTFFILE, GENOMEDIR, infile2, infile1, OUTPREFIX, whitelist, soloumilen, solocblen, soloumistart)
    ```

    Please advise.

    Thanks and good day.

Latest Articles

Collapse

  • seqadmin
    Exploring the Dynamics of the Tumor Microenvironment
    by seqadmin




    The complexity of cancer is clearly demonstrated in the diverse ecosystem of the tumor microenvironment (TME). The TME is made up of numerous cell types and its development begins with the changes that happen during oncogenesis. “Genomic mutations, copy number changes, epigenetic alterations, and alternative gene expression occur to varying degrees within the affected tumor cells,” explained Andrea O’Hara, Ph.D., Strategic Technical Specialist at Azenta. “As...
    07-08-2024, 03:19 PM
  • seqadmin
    Exploring Human Diversity Through Large-Scale Omics
    by seqadmin


    In 2003, researchers from the Human Genome Project (HGP) announced the most comprehensive genome to date1. Although the genome wasn’t fully completed until nearly 20 years later2, numerous large-scale projects, such as the International HapMap Project and 1000 Genomes Project, continued the HGP's work, capturing extensive variation and genomic diversity within humans. Recently, newer initiatives have significantly increased in scale and expanded beyond genomics, offering a more detailed...
    06-25-2024, 06:43 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, Today, 06:53 AM
0 responses
11 views
0 likes
Last Post seqadmin  
Started by seqadmin, 07-10-2024, 07:30 AM
0 responses
32 views
0 likes
Last Post seqadmin  
Started by seqadmin, 07-03-2024, 09:45 AM
0 responses
203 views
0 likes
Last Post seqadmin  
Started by seqadmin, 07-03-2024, 08:54 AM
0 responses
213 views
0 likes
Last Post seqadmin  
Working...
X