Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • crh
    Member
    • Dec 2009
    • 46

    #1

    sorting sam file

    Hi All,

    I've read the archives and see where this problem has been addressed previously, but I've been unable to sort a sam file to feed into cufflinks.
    Here is an excerpt from the sam file:



    @SQ SN:chromosome_1 LN:9982135
    @SQ SN:chromosome_2 LN:9975745
    @SQ SN:chromosome_3 LN:7773333
    @SQ SN:chromosome_4 LN:3005669
    @SQ SN:chromosome_5 LN:3366352
    @SQ SN:chromosome_6 LN:7695193
    @SQ SN:chromosome_7 LN:6170768
    @SQ SN:chromosome_8 LN:4189090
    @SQ SN:chromosome_9 LN:4733070
    @SQ SN:chromosome_10 LN:6579462
    @SQ SN:chromosome_11 LN:2734619
    @SQ SN:chromosome_12 LN:9355449
    @SQ SN:chromosome_13 LN:6588689
    @SQ SN:chromosome_14 LN:4114342
    @SQ SN:chromosome_15 LN:3066274
    @SQ SN:chromosome_16 LN:6617689
    @SQ SN:chromosome_17 LN:6673064
    @SQ SN:scaffold_18 LN:1287285
    @SQ SN:scaffold_19 LN:814470
    @SQ SN:scaffold_20 LN:598575
    @SQ SN:scaffold_21 LN:558747
    @SQ SN:scaffold_22 LN:430403
    @SQ SN:scaffold_23 LN:373397
    @SQ SN:scaffold_24 LN:339605
    @SQ SN:scaffold_25 LN:333029
    @SQ SN:scaffold_26 LN:317769
    @SQ SN:scaffold_27 LN:256895
    @SQ SN:scaffold_28 LN:253209
    @SQ SN:scaffold_29 LN:245379
    @SQ SN:scaffold_30 LN:238238
    @SQ SN:scaffold_31 LN:222931
    @SQ SN:scaffold_32 LN:217100
    @SQ SN:scaffold_33 LN:214180
    @SQ SN:scaffold_34 LN:186456
    @SQ SN:scaffold_35 LN:179663
    @SQ SN:scaffold_36 LN:154127
    @SQ SN:scaffold_37 LN:123055
    @SQ SN:scaffold_38 LN:120767
    @SQ SN:scaffold_39 LN:119177
    @SQ SN:scaffold_40 LN:116725
    @SQ SN:scaffold_41 LN:99905
    @SQ SN:scaffold_42 LN:98780
    @SQ SN:scaffold_43 LN:80533
    @SQ SN:scaffold_44 LN:80252
    @SQ SN:scaffold_45 LN:79195
    @SQ SN:scaffold_46 LN:72145
    @SQ SN:scaffold_47 LN:67355
    @SQ SN:scaffold_48 LN:66577
    @SQ SN:scaffold_49 LN:65629
    @SQ SN:scaffold_50 LN:63401
    @SQ SN:scaffold_51 LN:63266
    @SQ SN:scaffold_52 LN:59018
    @SQ SN:scaffold_53 LN:55340
    @SQ SN:scaffold_54 LN:54374
    @SQ SN:scaffold_55 LN:50490
    @SQ SN:scaffold_56 LN:47028
    @SQ SN:scaffold_57 LN:46469
    @SQ SN:scaffold_58 LN:45221
    @SQ SN:scaffold_59 LN:43590
    @SQ SN:scaffold_60 LN:43313
    @SQ SN:scaffold_61 LN:39687
    @SQ SN:scaffold_62 LN:38880
    @SQ SN:scaffold_63 LN:36644
    @SQ SN:scaffold_64 LN:36299
    @SQ SN:scaffold_65 LN:36037
    @SQ SN:scaffold_66 LN:32450
    @SQ SN:scaffold_67 LN:30996
    @SQ SN:scaffold_68 LN:29908
    @SQ SN:scaffold_69 LN:29423
    @SQ SN:scaffold_70 LN:28937
    @SQ SN:scaffold_71 LN:28038
    @SQ SN:scaffold_72 LN:26265
    @SQ SN:scaffold_73 LN:25979
    @SQ SN:scaffold_74 LN:25574
    @SQ SN:scaffold_75 LN:25288
    @SQ SN:scaffold_76 LN:23213
    @SQ SN:scaffold_77 LN:22385
    @SQ SN:scaffold_78 LN:21742
    @SQ SN:scaffold_79 LN:21191
    @SQ SN:scaffold_80 LN:20468
    @SQ SN:scaffold_81 LN:20314
    @SQ SN:scaffold_82 LN:20067
    @SQ SN:scaffold_83 LN:18413
    @SQ SN:scaffold_84 LN:15458
    @SQ SN:scaffold_85 LN:13564
    @SQ SN:scaffold_86 LN:12875
    @SQ SN:scaffold_87 LN:12675
    @SQ SN:scaffold_88 LN:8671
    USI-EAS39:1:1:2:1362#0/1_3[0] 65 chromosome_2 28825 30 35M * 0 0 CTGGGTTCCACAGGCACATAGCCAAACCGGTGCCT ``]XD\a``b`b`^aa`aaaa`a]^aaa\UZ^^a^ NM:i:1 MD:Z:4T30
    USI-EAS39:1:1:2:1276#0/1_3[0] 65 chromosome_12 6073621 30 35M * 0 0 GTTCGCTTTACACCGTAACATATTCAGCCAAATGC ]_aWDK\bbaaba_Y]ababbaaa`ba`abbab]` NM:i:0 MD:Z:35
    USI-EAS39:1:1:2:1649#0/1_3[0] 81 chromosome_17 6301050 30 35M * 0 0 GCTCCAACAACAAGACCTCCTGACATAAGACTCAC ^`_a`a`P__Xaaa]_X^``aa`bbbbba^D[a^a NM:i:1 MD:Z:30G4


    I generated the sam file using:
    samtools view -h -S -t ~/binf/seq/genome/chlre4/Chlre4_genomic_scaffolds.fasta.fai -o test_sorted.sam soap_mapped_reads.sam

    If I run cufflinks, I get the error:

    cufflinks -G ~/binf/sto1/models.gtf test_sorted.sam

    [bam_header_read] EOF marker is absent.
    [bam_header_read] invalid BAM binary header (this is not a BAM file).
    File test_sorted.sam doesn't appear to be a valid BAM file, trying SAM...
    [23:01:46] Loading reference annotation.
    [23:01:51] Inspecting reads and determining fragment length distribution.
    > Processing Locus chromosome_17:6295360-62958 [**** ] 18%
    Error: this SAM file doesn't appear to be correctly sorted!
    current hit is at chromosome_15:2745584, last one was at chromosome_17:6301049
    Cufflinks requires that if your file has SQ records in
    the SAM header that they appear in the same order as the chromosomes names
    in the alignments.
    If there are no SQ records in the header, or if the header is missing,
    the alignments must be sorted lexicographically by chromsome
    name and by position.


    So, the sam file is not correctly sorted.
    If I sort using:
    sort -k 3,3 -k 4,4n test_sorted.sam > test2_sorted.sam

    I loose the header, and get the same error when attempting to run cufflinks:
    [23:08:38] Loading reference annotation.
    [23:08:43] Inspecting reads and determining fragment length distribution.
    > Processing Locus scaffold_88:8392-8579 [************************ ] 98%
    Error: this SAM file doesn't appear to be correctly sorted!
    current hit is at scaffold_82:5078, last one was at scaffold_81:18777
    Cufflinks requires that if your file has SQ records in


    I guess the question is how to sort 'chromosome_1'?

    charles
  • peromhc
    Senior Member
    • Sep 2009
    • 108

    #2
    I had a, identical error message when I had colons ":" in my original fasta file.. I'd check that if I were you!

    Comment

    • crh
      Member
      • Dec 2009
      • 46

      #3
      I've checked, and there are no colons within the genomic fasta file
      charles

      Comment

      Latest Articles

      Collapse

      • SEQadmin2
        Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
        by SEQadmin2



        CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

        Despite this, “CRISPR helped turn genome editing from a specialized technique into
        ...
        07-31-2026, 11:01 AM
      • SEQadmin2
        Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
        by SEQadmin2


        Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

        The systematic characterization of the human proteome has
        ...
        07-20-2026, 11:48 AM

      ad_right_rmr

      Collapse

      News

      Collapse

      Topics Statistics Last Post
      Started by SEQadmin2, 08-13-2026, 12:22 PM
      0 responses
      25 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 08-11-2026, 10:35 AM
      0 responses
      20 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 08-06-2026, 07:41 AM
      0 responses
      33 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 08-03-2026, 10:13 AM
      0 responses
      51 views
      0 reactions
      Last Post SEQadmin2  
      Working...