Header Leaderboard Ad

Collapse

Truncated BAM files from 1000GP

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Truncated BAM files from 1000GP

    I got this error message from SAMTOOLS:

    samtools view -q 30 NA12878.chrom1.SLX.maq.SRP000032.2009_07.bam 1:532036-533055
    [bam_header_read] EOF marker is absent. The input is probably truncated.
    V_0003_FC3009KAAXX:2:22:1481:1181 99 1 531990 72 47M = 532035 92 TTAGGGTGCCTGGGTAATAGCAGAGGAAGAAAAAGGCTTAGAGTTGG +>[email protected]?>+A::[email protected]=::7<[email protected][email protected]<8:<88:::=:2<1.<.;5-93 RG:Z:SRR001134 MF:i:18 Aq:i:0 NM:i:1 UQ:i:30 H0:i:0 H1:i:6


    when using this BAM file from the 1000GP: ftp://ftp.1000genomes.ebi.ac.uk/vol1...32.2009_07.bam

    Is a truncated file a sign of something seriously wrong? I am using SAMTOOLS v. 0.1.16 if that helps.

  • #2
    A truncated file means it didn't get copied properly - check the size (in bytes) matches the original. I would further suggest verifying the md5 checksum, but it doesn't look like these are provided at ftp://ftp.1000genomes.ebi.ac.uk/vol1...878/alignment/

    I've also seen this "EOF marker is absent" on a valid BAM file when using an old version of samtools. Can you double check which version of samtools you are running?

    Comment


    • #3
      from samtools NEWS file ...

      Beta Release 0.1.6 (2 September, 2009)
      ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

      Notable changes:
      ...

      * BAM files now have an end-of-file (EOF) marker to facilitate
      truncation detection. A warning will be given if an on-disk BAM file
      does not have this marker. The warning will be seen on BAM files
      generated by an older version of samtools. It does NO harm.

      Comment


      • #4
        Ah - so it would be nice if instead of this:

        [bam_header_read] EOF marker is absent. The input is probably truncated.

        it said this:

        [bam_header_read] EOF marker is absent. The input is probably truncated, or was from samtools prior to v0.1.6.

        Given the samtools 0.1.6 was released about a year and a half ago, I guess it is uncommon to fall over this issue unless re-analysing old data.

        Comment


        • #5
          Hi,

          I am using tophat to align my reads and created a non-sorted bam files to do the sorting separately.

          When I run
          samtools view -h tophat_out_dilp/accepted_hits.bam | head -n 30

          I also get the error message
          "[bam_header_read] EOF marker is absent. The input is probably truncated."

          I am using the samtools Version: 0.1.16 (r963:234)
          Does tophat uses a different version of samtools?

          I can't explain this message otherwise.

          Does it means anything about the file or can I still work with it normally?

          Thanks

          Assa

          Comment

          Latest Articles

          Collapse

          • seqadmin
            A Brief Overview and Common Challenges in Single-cell Sequencing Analysis
            by seqadmin


            ​​​​​​The introduction of single-cell sequencing has advanced the ability to study cell-to-cell heterogeneity. Its use has improved our understanding of somatic mutations1, cell lineages2, cellular diversity and regulation3, and development in multicellular organisms4. Single-cell sequencing encompasses hundreds of techniques with different approaches to studying the genomes, transcriptomes, epigenomes, and other omics of individual cells. The analysis of single-cell sequencing data i...

            01-24-2023, 01:19 PM
          • seqadmin
            Introduction to Single-Cell Sequencing
            by seqadmin
            Single-cell sequencing is a technique used to investigate the genome, transcriptome, epigenome, and other omics of individual cells using high-throughput sequencing. This technology has provided many scientific breakthroughs and continues to be applied across many fields, including microbiology, oncology, immunology, neurobiology, precision medicine, and stem cell research.

            The advancement of single-cell sequencing began in 2009 when Tang et al. investigated the single-cell transcriptomes
            ...
            01-09-2023, 03:10 PM

          ad_right_rmr

          Collapse
          Working...
          X