Truncated BAM files from 1000GP

[gene coder]

I got this error message from SAMTOOLS:

samtools view -q 30 NA12878.chrom1.SLX.maq.SRP000032.2009_07.bam 1:532036-533055
[bam_header_read] EOF marker is absent. The input is probably truncated.
V_0003_FC3009KAAXX:2:22:1481:1181 99 1 531990 72 47M = 532035 92 TTAGGGTGCCTGGGTAATAGCAGAGGAAGAAAAAGGCTTAGAGTTGG +>5@?>+A::BA@=::7<8@78?3@<8:<88:::=:2<1.<.;5-93 RG:Z:SRR001134 MF:i:18 Aq:i:0 NM:i:1 UQ:i:30 H0:i:0 H1:i:6

when using this BAM file from the 1000GP: ftp://ftp.1000genomes.ebi.ac.uk/vol1...32.2009_07.bam

Is a truncated file a sign of something seriously wrong? I am using SAMTOOLS v. 0.1.16 if that helps.

[maubp]

A truncated file means it didn't get copied properly - check the size (in bytes) matches the original. I would further suggest verifying the md5 checksum, but it doesn't look like these are provided at ftp://ftp.1000genomes.ebi.ac.uk/vol1...878/alignment/

I've also seen this "EOF marker is absent" on a valid BAM file when using an old version of samtools. Can you double check which version of samtools you are running?

[Richard Finney]

from samtools NEWS file ...

Beta Release 0.1.6 (2 September, 2009)
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

Notable changes:
...

* BAM files now have an end-of-file (EOF) marker to facilitate
truncation detection. A warning will be given if an on-disk BAM file
does not have this marker. The warning will be seen on BAM files
generated by an older version of samtools. It does NO harm.

[maubp]

Ah - so it would be nice if instead of this:

[bam_header_read] EOF marker is absent. The input is probably truncated.

it said this:

[bam_header_read] EOF marker is absent. The input is probably truncated, or was from samtools prior to v0.1.6.

Given the samtools 0.1.6 was released about a year and a half ago, I guess it is uncommon to fall over this issue unless re-analysing old data.

[frymor]

Hi,

I am using tophat to align my reads and created a non-sorted bam files to do the sorting separately.

When I run
samtools view -h tophat_out_dilp/accepted_hits.bam | head -n 30

I also get the error message
"[bam_header_read] EOF marker is absent. The input is probably truncated."

I am using the samtools Version: 0.1.16 (r963:234)
Does tophat uses a different version of samtools?

I can't explain this message otherwise.

Does it means anything about the file or can I still work with it normally?

Thanks

Assa