Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • EmmaB
    Junior Member
    • Jun 2011
    • 7

    Problem generating consensus files

    Hello all,

    I have been having trouble generating consensus files from sorted BAM files.

    I have tried both the mpileup command-

    samtools mpileup -uf ./genomes/NC_013316.fna 2245.sorted.bam | ../samtools-0.1.16/bcftools/bcftools view -cg - | ../samtools-0.1.16/bcftools/vcfutils.pl vcf2fq > 2245cns.fq

    and the depreciated pileup command -

    samtools pileup -cf ./genomes/NC_013316.fna 2245.sorted.bam | ../samtools-0.1.16/misc/samtools.pl pileup2fq -D150 > 2245pcns.fastq

    Both commands run correctly, however when I look at the fastq file it truncates at line 69857 and the rest of the files is filled with this character ( ~~~~) and random letters, as shown below -

    TCCATAAATTTAGTTATTCTGTAAAATTTATATATATTTTTGCTTTTCTGTTAATAACTT
    TGTGGAAAATATTAATTATTCTGTTCGGAGGTTTATatt
    +
    ?BBEEEEHNNNNNZZ`ccffiiloru~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
    ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
    ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

    Can anyone please explain what may be going on?
    I am very new to seq analysis and can't work it out!

    Emma
  • EmmaB
    Junior Member
    • Jun 2011
    • 7

    #2
    please ignore the last post!

    PLease ignore the last post, I have just realised that I have not converted my file to fasta, therefore I still have the quality called in the fastq file!

    Comment

    • leirhyh
      Junior Member
      • Sep 2012
      • 3

      #3
      samtools to convert Bam file to consensus sequence

      Hi, all:
      I tried to covert Bam file to consensus sequence as follow command:

      Samtools pileup -cf primatecom-sorted.bam samtools.pl pileup2fq -D100 > primate.fa

      error as follows:
      the Pileup command has been removed. please use mpileup instead.

      according to EmmBB, I tried mpileup. However, I didn't find samtools-0.1.18/bcftools/bcftools.

      Could you help me for this matter?

      Thank you very much,

      Runhua

      Comment

      Latest Articles

      Collapse

      • SEQadmin2
        Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
        by SEQadmin2



        Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
        ...
        07-09-2026, 11:10 AM
      • SEQadmin2
        Cancer Drug Resistance: The Lingering Barrier to Rising Survival
        by SEQadmin2



        Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

        There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
        07-08-2026, 05:17 AM
      • GATTACAT
        Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
        by GATTACAT
        Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
        07-01-2026, 11:43 AM

      ad_right_rmr

      Collapse

      News

      Collapse

      Topics Statistics Last Post
      Started by SEQadmin2, Today, 10:26 AM
      0 responses
      9 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-09-2026, 10:04 AM
      0 responses
      24 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-08-2026, 10:08 AM
      0 responses
      16 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-07-2026, 11:05 AM
      0 responses
      33 views
      0 reactions
      Last Post SEQadmin2  
      Working...