Hi
I have the following sequence off of a paired end HiSeq2000 run:
@UNC11-SN627_0113:1:1101:1382:2135#0/1
TTAAGGTTTTCACTGGTATAAATCTTTCTATATTGAGACAAAATTTAAGA
+UNC11-SN627_0113:1:1101:1382:2135#0/1
bbbeeeeegggggiiigiiiiiiiiiiiiiiiiiiihiiiihiiiiiiih
I am trying to use FASTX to generate a box plot of phred quality scores and it cannot handle the score of "i". None of the scoring systems (sanger, illumina 1.x+, etc.) seem to use "i" as far as I can tell.
Does anyone know what is happening here (what version I have here) and how I can generate a box plot like this would be extremely appreciated?
Thanks
I have the following sequence off of a paired end HiSeq2000 run:
@UNC11-SN627_0113:1:1101:1382:2135#0/1
TTAAGGTTTTCACTGGTATAAATCTTTCTATATTGAGACAAAATTTAAGA
+UNC11-SN627_0113:1:1101:1382:2135#0/1
bbbeeeeegggggiiigiiiiiiiiiiiiiiiiiiihiiiihiiiiiiih
I am trying to use FASTX to generate a box plot of phred quality scores and it cannot handle the score of "i". None of the scoring systems (sanger, illumina 1.x+, etc.) seem to use "i" as far as I can tell.
Does anyone know what is happening here (what version I have here) and how I can generate a box plot like this would be extremely appreciated?
Thanks
Comment