Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • ashwatha
    Member
    • Jul 2011
    • 14

    #1

    SAM validation errors

    Hi,

    I need some help understanding these errors when I use picard to validate a SAM/BAM file:


    $java -jar picard-tools-1.50/ValidateSamFile.jar I=somebam.bam
    ERROR: Read groups is empty
    ERROR: Record 38, Read name V15-13:3:73:1694:1074, CIGAR should have zero elements for unmapped read.
    ERROR: Record 37, Read name V15-13:3:73:1694:1074, Mate negative strand flag does not match read negative strand flag of mate

    What does this error mean? I understand why an unmapped read should have zero elements in the CIGAR string, but reads at records 37 and 38 seem to be mapped. Can someone help me understand this error? These are the corresponding records from the SAM file:

    V15-13:3:73:1694:1074 89 chr1 325709 0 69S46M = 325709 0 GTGGCTGACTATGGAAGCCCAAGTCTTCCTCAAATCCGGCTTTTGCCCAACTTCTGACTACTGTCGGACTCTACAGGTCAGCCTCTGCCTCACAGTGGACCCTCCAGACCCAGAT ######################################################################CA,ECEA<EC>AA+BAABB+EC4EGGGGDD<D8BFGDDGGGGGEG XC:i:46 XT:A:R NM:i:0 SM:i:0 AM:i:0 X0:i:5 X1:i:13 XM:i:0 XO:i:0 XG:i:0 MD:Z:46

    V15-13:3:73:1694:1074 181 chr1 325709 0 58M57S = 325709 0 TTCTGGCAGGAGGACTTTTGGCGCCGACATTGGCCGCCAGGCGCTAGACAGGCCCTGGGCCAAAAAAGGCTGTTGTTAGGCAGCGGTTGTGCCGGTGGCCCCAGCCAAGAGGAAG ##########################################################??37B<?35991*9773,+>8@=7>228?B,B775''=-B,BDDGG?EB:F=?@BEE XC:i:58

    Thanks!
    -- Ashwatha.
  • av_d
    Member
    • Sep 2009
    • 12

    #2
    READ: V15-13:3:73:1694:1074
    FLAG: 89
    (read paired, mate unmapped, read reverse strand, first in pair)



    RNAME: chr1

    MRNM: = (? that should not be)

    READ: V15-13:3:73:1694:1074 (mate)
    FLAG: 181
    (read paired, read unmapped, read reverse strand, mate reverse strand, second in pair)

    RNAME: chr1 (? but this read in not mapped)


    you can fix them using FixMateInformation of Picard, otherwise use VALIDATION_STRINGENCY=SILENT

    Comment

    • ashwatha
      Member
      • Jul 2011
      • 14

      #3
      Thank you for the help.

      Comment

      Latest Articles

      Collapse

      • SEQadmin2
        Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
        by SEQadmin2



        CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

        Despite this, “CRISPR helped turn genome editing from a specialized technique into
        ...
        07-31-2026, 11:01 AM
      • SEQadmin2
        Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
        by SEQadmin2


        Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

        The systematic characterization of the human proteome has
        ...
        07-20-2026, 11:48 AM
      • SEQadmin2
        Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
        by SEQadmin2



        Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
        ...
        07-09-2026, 11:10 AM

      ad_right_rmr

      Collapse

      News

      Collapse

      Topics Statistics Last Post
      Started by SEQadmin2, 08-03-2026, 10:13 AM
      0 responses
      15 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-31-2026, 02:55 AM
      0 responses
      32 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-24-2026, 12:17 PM
      0 responses
      23 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-23-2026, 11:41 AM
      0 responses
      21 views
      0 reactions
      Last Post SEQadmin2  
      Working...