Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • ashwatha
    Member
    • Jul 2011
    • 14

    SAM validation errors

    Hi,

    I need some help understanding these errors when I use picard to validate a SAM/BAM file:


    $java -jar picard-tools-1.50/ValidateSamFile.jar I=somebam.bam
    ERROR: Read groups is empty
    ERROR: Record 38, Read name V15-13:3:73:1694:1074, CIGAR should have zero elements for unmapped read.
    ERROR: Record 37, Read name V15-13:3:73:1694:1074, Mate negative strand flag does not match read negative strand flag of mate

    What does this error mean? I understand why an unmapped read should have zero elements in the CIGAR string, but reads at records 37 and 38 seem to be mapped. Can someone help me understand this error? These are the corresponding records from the SAM file:

    V15-13:3:73:1694:1074 89 chr1 325709 0 69S46M = 325709 0 GTGGCTGACTATGGAAGCCCAAGTCTTCCTCAAATCCGGCTTTTGCCCAACTTCTGACTACTGTCGGACTCTACAGGTCAGCCTCTGCCTCACAGTGGACCCTCCAGACCCAGAT ######################################################################CA,ECEA<EC>AA+BAABB+EC4EGGGGDD<D8BFGDDGGGGGEG XC:i:46 XT:A:R NM:i:0 SM:i:0 AM:i:0 X0:i:5 X1:i:13 XM:i:0 XO:i:0 XG:i:0 MD:Z:46

    V15-13:3:73:1694:1074 181 chr1 325709 0 58M57S = 325709 0 TTCTGGCAGGAGGACTTTTGGCGCCGACATTGGCCGCCAGGCGCTAGACAGGCCCTGGGCCAAAAAAGGCTGTTGTTAGGCAGCGGTTGTGCCGGTGGCCCCAGCCAAGAGGAAG ##########################################################??37B<?35991*9773,+>8@=7>228?B,B775''=-B,BDDGG?EB:F=?@BEE XC:i:58

    Thanks!
    -- Ashwatha.
  • av_d
    Member
    • Sep 2009
    • 12

    #2
    READ: V15-13:3:73:1694:1074
    FLAG: 89
    (read paired, mate unmapped, read reverse strand, first in pair)



    RNAME: chr1

    MRNM: = (? that should not be)

    READ: V15-13:3:73:1694:1074 (mate)
    FLAG: 181
    (read paired, read unmapped, read reverse strand, mate reverse strand, second in pair)

    RNAME: chr1 (? but this read in not mapped)


    you can fix them using FixMateInformation of Picard, otherwise use VALIDATION_STRINGENCY=SILENT

    Comment

    • ashwatha
      Member
      • Jul 2011
      • 14

      #3
      Thank you for the help.

      Comment

      Latest Articles

      Collapse

      • SEQadmin2
        Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
        by SEQadmin2



        Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
        ...
        07-09-2026, 11:10 AM
      • SEQadmin2
        Cancer Drug Resistance: The Lingering Barrier to Rising Survival
        by SEQadmin2



        Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

        There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
        07-08-2026, 05:17 AM
      • GATTACAT
        Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
        by GATTACAT
        Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
        07-01-2026, 11:43 AM

      ad_right_rmr

      Collapse

      News

      Collapse

      Topics Statistics Last Post
      Started by SEQadmin2, 07-13-2026, 10:26 AM
      0 responses
      24 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-09-2026, 10:04 AM
      0 responses
      34 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-08-2026, 10:08 AM
      0 responses
      21 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-07-2026, 11:05 AM
      0 responses
      34 views
      0 reactions
      Last Post SEQadmin2  
      Working...