Problem Encountered When Using SOAPdenovo: Floating Point / Segmentation Error
Hi, Dear Colleagues:
I'm a student from Fudan University, and is currently trying to use SOAPdenovo to run de novo assemble on human mitochondrial genome sequencing data. These data are either downloaded from the 1000Genome Project website (which is sequenced by Illumina or SOLiD sequencers) or sequenced by our lab using Illumina HiSeq2000 sequencers. The coverage of reads are low to moderate, from 20x to 50x.
The configuration of computer I used to run SOAPdenovo is as follows:
Intel Core i7 Quad 2.3GHz, 8GB of RAM, 750GB HDD, Mac OS X 10.7.2 and running SOAPdenovo 1.05 ver 63.
The problem I encountering is when I tried to using SOAPdenovo to construct scaffolds. I've tested different kmer values, from 13 (the minimum allowance of SOAPdenovo) to 43 (the maximum I can run on this computer), yet all of the tests have returned a "Segmentation fault: 11" or a "Floating point exception: 8" error.
Furthermore, I found the contig constructed by SOAPdenovo is significantly smaller thant the 454 de novo assembler. The biggest contig constructed by SOAPdenovo is only about 600bp long, yet the biggest contig constructed by 454 de novo assembler is more than 7,000bp.
To help you to analyze the problem, I've attached the configuration file, as well as the sample reads I've used, at the end of this post.
Your kind reply will be quite appreciated.
Thanks.
Configuration File:
max_rd_len=100
[LIB]
avg_ins=500
reverse_seq=0
asm_flags=3
rank=1
q1=/Users/AndyDing/Server/data/111121/NA19308_f.fq
q2=/Users/AndyDing/Server/data/111121/NA19308_r.fq
Sample Reads:
@SRR042435.101073000/1
ACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCC
+
><5@A?>@B;A<B=>@<@@A<A<<<@@BC@B<=A<@;A<4<=;;;?797I
@SRR042435.101149159/1
GATGGATCACANNTCTATCACCCTATTAACCACTCACNNGAGCTCTNNAT
+
>AA?=AB:A<A!!?<A@B<A<=>A@AC?B<<A;@<@<!!>A;:?;?!!5I
I'm a student from Fudan University, and is currently trying to use SOAPdenovo to run de novo assemble on human mitochondrial genome sequencing data. These data are either downloaded from the 1000Genome Project website (which is sequenced by Illumina or SOLiD sequencers) or sequenced by our lab using Illumina HiSeq2000 sequencers. The coverage of reads are low to moderate, from 20x to 50x.
The configuration of computer I used to run SOAPdenovo is as follows:
Intel Core i7 Quad 2.3GHz, 8GB of RAM, 750GB HDD, Mac OS X 10.7.2 and running SOAPdenovo 1.05 ver 63.
The problem I encountering is when I tried to using SOAPdenovo to construct scaffolds. I've tested different kmer values, from 13 (the minimum allowance of SOAPdenovo) to 43 (the maximum I can run on this computer), yet all of the tests have returned a "Segmentation fault: 11" or a "Floating point exception: 8" error.
Furthermore, I found the contig constructed by SOAPdenovo is significantly smaller thant the 454 de novo assembler. The biggest contig constructed by SOAPdenovo is only about 600bp long, yet the biggest contig constructed by 454 de novo assembler is more than 7,000bp.
To help you to analyze the problem, I've attached the configuration file, as well as the sample reads I've used, at the end of this post.
Your kind reply will be quite appreciated.
Thanks.
Configuration File:
max_rd_len=100
[LIB]
avg_ins=500
reverse_seq=0
asm_flags=3
rank=1
q1=/Users/AndyDing/Server/data/111121/NA19308_f.fq
q2=/Users/AndyDing/Server/data/111121/NA19308_r.fq
Sample Reads:
@SRR042435.101073000/1
ACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCC
+
><5@A?>@B;A<B=>@<@@A<A<<<@@BC@B<=A<@;A<4<=;;;?797I
@SRR042435.101149159/1
GATGGATCACANNTCTATCACCCTATTAACCACTCACNNGAGCTCTNNAT
+
>AA?=AB:A<A!!?<A@B<A<=>A@AC?B<<A;@<@<!!>A;:?;?!!5I