help to install 'FAR - The Flexible Adapter Remover' on Mac OS

[joseph]

can you please show me how to install FAR on Mac OS?
I was not able to install it when I followed the instructions in Readme.txt

http://sourceforge.net/apps/mediawiki/theflexibleadap/index.php?title=Main_Page

Thanks
Joseph

[ECO]

Maybe report what errors you encountered...?

[joseph]

Maybe report what errors you encountered...?

these are the instructions from Readme.txt:
MacOSX: Copy the libtbb.dylib from ./lib into your lib searchpath.

I copied ibtbb.dylib to /usr/local/bin
but I am not able to figure out from the instructions what are the next steps after copying this file to /usr/local/bin.

I tried to run it:
far --adapters adapters.fasta --source test.fa --target test_result.fa --format fasta --log-level ALL --cut-off 4 --min-overlap 6
-bash: far: command not found

thanks

[ECO]

I can't get it to run either. Seems there are either files missing and/or it's not compiled correctly for OSX...shame, seems like a cool utility!

[dawe]

I can't get it to run either. Seems there are either files missing and/or it's not compiled correctly for OSX...shame, seems like a cool utility!

Guys, where's the OS X binary? Anyway, I'm trying to build my own TBB and FAR. Meanwhile, you should check if link path of libtbb.dylib is properly set:

$ otool -L libtbb.dylib

The first line should be the path you want it to be (i.e. /usr/local/lib). You may change it by

$ install_name_tool -id /usr/local/lib/libtbb.dylib libtbb.dylib

In precompiled far you should change it by issuing

$ install_name_tool -change /path/to/libtbb.dylib /usr/local/lib/libtbb.dylib far

This hopefully should work (although it is hard to guess without the error you get).
@joseph: your far installation should be in a directory in the PATH env variable :-)

[dawe]

BTW, build from source works. If you need a precompiled binary I can provide one.

[joseph]

BTW, build from source works. If you need a precompiled binary I can provide one.

yes, please send me a precompiled binary.
Thank you.
Joseph

[dawe]

yes, please send me a precompiled binary.
Thank you.
Joseph

You can download it here. Uncompress in /usr/local:

sudo tar xvzf far.tgz -C /usr/local

it should be working.

d

[kga1978]

Hey dawe,

Thanks for uploading the binary - very helpful!

[dawe]

AFAIK it doesn't understand gzipped fastq. You should try with a subshell, i.e.

far -s <(zcat G676_subsampled.fastq.gz) -f fastq -o 6 -th 6 -a contaminants.fasta -t stdout

[joseph]

You can download it here. Uncompress in /usr/local:

sudo tar xvzf far.tgz -C /usr/local

it should be working.

d

It works. Thank you.

[ETHANol]

I tried to install dawe's precompiled binary (Thanks for sharing!!!). It is for OSX correct?
I ran:

sudo tar xvzf far.tgz -C /usr/local

Then I made a couple short test files if fasta format because it is the most simple.

And this is what I get:

$ far -s fartest.fasta -t fartestout.fa -f fasta -a IlluminaAdapters.fa
source file was set to fartest.fasta.
No 2nd input file specified! (Run is not paired)

target file was set to fartestout.fa.
File format was set to FASTA
Will do demultiplexing and adapter removal... 
Adapter file: IlluminaAdapters.fa

Nr. of allowed indels + mismatches per 10 bases: 2

Allowed number of uncalled bases was set to 0
Chosen scoring scheme: match = 3 ,mismatch = -3 ,gap opening = -20
Trimming from right end. 
Minimum required overlap: 10
Overlap will be treated as standard overlap. 
Segmentation fault

Not sure what a segmentation fault is, but could it be that the precompiled binary dawe posted isn't exactly right for my computer?

[joseph]

Hi Ethan
it worked fine for me

 far --source myfile.fastq --target myoutput.fastq --format fastq --adapters adapters.fasta --nr-threads 4 

far --source SRR309288.fastq --target SRR309288_far_trim --format fastq --adapters adapter.fa --nr-threads 2 
source file was set to SRR309288.fastq.
No 2nd input file specified! (Run is not paired)
target file was set to SRR309288_far_trim.
File format was set to FASTQ-illumina15
Will do demultiplexing and adapter removal... 
Adapter file: adapter.fa
Nr. of allowed indels + mismatches per 10 bases: 2
Allowed number of uncalled bases was set to 0
Chosen scoring scheme: match = 3 ,mismatch = -3 ,gap opening = -20
Trimming from right end. 
Minimum required overlap: 10
Overlap will be treated as standard overlap. 
Adapter sequences are:
adapter
TCGTATGCCGTCTTCTGCTTGT
No barcodes file specified... 
Minimum required readlength: 18
Using 2 threads.
Writing omitted read ids to: SRR309288.fastq.omitted
Using no phred-quality trimming.
Starting processing (algorithm: needleman-wunsch)...
Done.
Calculation Time: 28 minutes 53 seconds. 
Step 1 - filtering input files: 
=============================== 
Input file contained 13823407 reads.
Discarded in total 309069 reads due to containing uncalled bases.
Discarded in total 0 reads due to having low quality.
Used      13823407 reads from input file.
12037203 reads remaining ( 85.1741 % of input reads )
Statistics on each output file:
===============================
File: SRR309288_far_trim.fastq
Nr. of reads dropped due to being shorter than minLength: 1477135
Nr. of reads written to the file: 12037203
Writing length distributions of reads (for each file) 
Statistics on adapter removal (input files):
============================================
Adapter	removal_count
adapter	10847050
Min-/Max-/Mean-/Median-overlap length: 10 / 23 / 12 / 11

these are the files:

> head -20 SRR309288.fastq
@SRR309288.1 ILLUMINA-432AEC_0016:4:1:959:1667 length=36
NNNNNNNNCNNNNTNATGTTGACATCTCGTATGCCG
+SRR309288.1 ILLUMINA-432AEC_0016:4:1:959:1667 length=36
####################################
@SRR309288.2 ILLUMINA-432AEC_0016:4:1:959:8156 length=36
NNNNNNNNCNNNNNNTATGCCGTCTTCGGCTTGCAA
+SRR309288.2 ILLUMINA-432AEC_0016:4:1:959:8156 length=36
####################################
@SRR309288.3 ILLUMINA-432AEC_0016:4:1:959:1631 length=36
NNNNNNNNCNNNNTNATGTTGACATCTCGTATGCCG
+SRR309288.3 ILLUMINA-432AEC_0016:4:1:959:1631 length=36
####################################
@SRR309288.4 ILLUMINA-432AEC_0016:4:1:960:2745 length=36
NNNNNNNNCNNANANCATCTCGTATGCCGTCTTCTG
+SRR309288.4 ILLUMINA-432AEC_0016:4:1:960:2745 length=36
########(##'#1#4366.???>><>?>???>?>7
@SRR309288.5 ILLUMINA-432AEC_0016:4:1:960:1472 length=36
NNNNNNNNTNNANTNAGAAGGCATCTCGTATGCCGT
+SRR309288.5 ILLUMINA-432AEC_0016:4:1:960:1472 length=36
####################################


> head -20 SRR309288_far_trim
head: SRR309288_far_trim: No such file or directory
boyce-162-119:FAR jdhahbi$ head -20 SRR309288_far_trim.fastq
@SRR309288.531 ILLUMINA-432AEC_0016:4:1:1019:15214 length=36
CACCCGTAGAACCGACCTTGCATC
+
GFEGGFFAFDAECDCFFFDFEEGE
@SRR309288.532 ILLUMINA-432AEC_0016:4:1:1019:12253 length=36
CTGAGCCGAGAATGGGGATC
+
FF5FFFDFEDBADDD-DCAD
@SRR309288.533 ILLUMINA-432AEC_0016:4:1:1019:9688 length=36
GCATTGTGGTTCAGTGGTAGAATTCTCGATCTCGTA
+
:E?EEAEEEEBE?D?EEA?ED=DEE5EE-:DD-DDA
@SRR309288.534 ILLUMINA-432AEC_0016:4:1:1019:6554 length=36
TAGCTTATCAGACTGATGTTGACATC
+
FGGGGGGFGDEGGGGGGGGGFGGGGG
@SRR309288.535 ILLUMINA-432AEC_0016:4:1:1019:15771 length=36
TAGCTTATCAGACTGATGTTGACATC
+
GFGFFFA?DFE-BEDBFDFFF?F:EF

[ETHANol]

Okay, I'm stupid. Little mistake in my adapter file. Thanks for the code Joseph!! It showed me where to look.

[sklages]

@All,
are you happy with FAR or are you using other tools for (illumina) adpator/quality clipping?
I am trying to figure out which is the "best" one, in terms of flexibility and good results.

Currently I am playing around with far (surely developed for Mac as the Makefile needs to be fixed for compiling on linux). It seems quite flexible, "verbose" and it works on PE data directly.

Sven