Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Mapping to transcriptome with Bowtie2-beta5

    Hey guys,
    I wanted to map by brand new paired-end RNA-seq data to the mouse transcriptome using the current beta (b5) of Bowtie2.
    As I could not find any pre-build index for this, I build it myself using bowtie2-build to make an index of ensemble transcript information.
    The three mouse-fasta-files for this were downloaded from the ensemble ftp site . I wanted to get as much information as possible so I included cDNA-all, cDNA-abinitio and ncRNA fasta files for indexing.
    Then, I mapped the paired-end RNA-seq data to this index using the following command:
    ./bowtie2 -p 4 -t --local -x mouse_transcriptome_ensembl-NCBI37_ncRNA_cDNAall_abinitiopredictons -1 <matepair1.fastq> -2 <matepair2.fastq> -S output.sam
    So far so good, it all worked well with overall alignment rates of 80-90%.
    Now, when I want to import the data to SeqMonk, after reading all the lines it tells me that it "Couldn't extract valid name for <ensemble-tanscript-ID/Genscen-ID>" and leaves me with no reads at all... This is probably because there is no chromosome information or not in the expected position?

    From what I could find out, the ensemble-fasta-files also contain some "supercontigs" that do not have chromosome information but an NT-xxxx ID.
    But still, then there should be reads with the correct annotation, right?

    So what went wrong with my workflow here, and can I still rescue the SAM-files that I now produced?

    btw: the SAM file header looks like this:
    @HD VN:1.0 SO:unsorted
    @SQ SN:GENSCAN00000015589 LN:298
    @SQ SN:GENSCAN00000001573 LN:74
    @SQ SN:GENSCAN00000001572 LN:260
    @SQ SN:GENSCAN00000026402 LN:489
    ...
    @SQ SN:ENSMUST00000146092 LN:216
    @SQ SN:ENSMUST00000120435 LN:630
    @SQ SN:ENSMUST00000118023 LN:1647
    ...almost endlessly...
    and then the alignment comes, which looks like this:
    HWI-ST933:54:C01BFACXX:3:1101:10433:5230 99 ENSMUST00000082408 34 99M = 76 169 CGAAAATCTATTTGCCTCATTCATTACCCCAACAATAATAGGATTCCCAATCGTTGTAGCCATCATTATATTTCCTTCAATCCTATTCCCATCCTCAAA CCCFFFFFHHHHHJJJJJJJJJJJJJJJJJJJJJIJJJJJIJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJAHHHHHFFFFFFEEEDEEDDDDDD AS:i:198 XS:i:98 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:99YS:i:198 YT:Z:CP

Latest Articles

Collapse

  • seqadmin
    Latest Developments in Precision Medicine
    by seqadmin



    Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.

    Somatic Genomics
    “We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...
    05-24-2024, 01:16 PM
  • seqadmin
    Recent Advances in Sequencing Analysis Tools
    by seqadmin


    The sequencing world is rapidly changing due to declining costs, enhanced accuracies, and the advent of newer, cutting-edge instruments. Equally important to these developments are improvements in sequencing analysis, a process that converts vast amounts of raw data into a comprehensible and meaningful form. This complex task requires expertise and the right analysis tools. In this article, we highlight the progress and innovation in sequencing analysis by reviewing several of the...
    05-06-2024, 07:48 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, 05-24-2024, 07:15 AM
0 responses
13 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-23-2024, 10:28 AM
0 responses
17 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-23-2024, 07:35 AM
0 responses
20 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-22-2024, 02:06 PM
0 responses
10 views
0 likes
Last Post seqadmin  
Working...
X