s_#_sorted.txt to BED

[apche93]

Hi all,

I am trying to convert the following type of code into bed format or really anything that I can view in IGV or IGB browsers. I think it is in eland sorted format, but not too sure.

HWI-EAS240      FC2087UAAXX     3       257     951     322                     TGTTGTCTCTCTTCTGGGTCTAGCCACCTAGCAAGT    [[[[[[[[[[[[[[[ZZU[[[[U[[Z[[X[VSSOVS    chr10.fasta             53590   R       33G2    0

I looked around and found that I might be able to use SAMTOOLS or FINDPEAKS. This is probably a simple conversion, but I'm not too familiar with the implementation of these programs so I'd really appreciate any help.

Thanks in advance!